1. Use the prokaryotic gene DNA sequence below to answer the following questions:111ATGAAGCTAC51TTTGCCCAGG101ACATCTGACA51101d. Where is the 3' UTR? Circle one.12-7235-72-35 consensus sequence:-10 consensus sequence (Pribnow box):Shine-Delgarno sequence in the corresponding mRNA:Start (initiation) codon in the corresponding mRNA:Stop (termination) codon in the corresponding mRNA:61a. Write the corresponding sequences, circle & label them in the sequence above:(label as -35)Genetic Code:First letterTTTGACAGTC TTCTATCGAA CAAGCATATA ATCAGCGATA111Uc. What will be the nascent polypeptide sequence translated from this mRNA?CGb. What region of this prokaryotic DNA sequence will be transcribed into mRNA? Circle one.1-12035-10854-14672-146UUUUUCUUAUUGCUUCUCCUACUGAGGTTTAACA ACATGTCAAG TGCTCCAAAG AAAAACCGAAc. Where is the 3' UTR? Circle one.70-11114-60AUUAUCAUAAUGGUUGUCGUAGUG-II. Use the eukaryotic gene DNA sequence below to answer the following questions:11121U61GGGAAAAAAT CCCCCCCCCC TTTTTTTTTTTTTTTTCCCGCGACTTACTG GGCGTATAAA GCGACGACTG TAGACTGATG AGCCTATCCA111TGGACGCGCC ATGGCCCTGT AAGCGGTGCG ATGCAATAAA21Phenylalanine.(Phe)71Leucine(Leu)Leucine(Leu)121Isoleucine(Ile)Methionine(Met)61-69Valine(Val)UCUUCCUCAUCGGTCATTCAGC GTAGTCTGAT GCCAGTCGAC TGCATTGGAC ACCGGTTACACCUCCCa. Write the corresponding sequences, circle & label them in the sequence above:TATA box sequence:(label as TATA)Polyadenylation signal in the corresponding mRNA:Kozak's sequence in the corresponding mRNA:Start (initiation) codon in the corresponding mRNA:Stop (termination) codon in the corresponding mRNA:CCACCGACUACCACAACG71GCUGCCGCAGCG121b. What region of mRNA contains the open reading frame that will be translated into protein?Circle one.51-111109-146CSerine(Ser)Proline(Pro)Second letterThreonine(Thr)Alanine(Ala)3173-9081UAU1312]UACUAAUAG37-45CAUCACCAACAGAAUAACAAAAAG(label as PB)GAUGACGAAGAG]nn31]JL81131Tyrosine(Tyr)StopStopHistidine(His)(label as SD)(label as start)Glutamine(Gln)(label as stop)121-146Asparagine(Asn)41Lysine(Lys)91Aspartic acid.(Asp)Glutamic acid(Glu)14141(label as poly-A)(label as Kozak)CGUCGCCGACGG91AGUACGCGTATCA(label as start)(label as stop)AGC141AGA71-81AGG85-150GGUGGCGGAGGGUGUUGCUGAStopUGG Tryptophan(Trp)]]Cysteine(Cys)Arginine(Arg)Serine(Ser)Arginine(Arg)Glycine(Gly)DUAG DUAU DUAG ULAGАC

Name: 1. Use the prokaryotic gene DNA sequence below to answer the followin
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 1. Use the prokaryotic gene DNA sequence below to answer the following questions:111ATGAAGCTAC51TTTGCCCAGG101ACATCTGACA51101d. Where is the 3' UTR? Circle one.12-7235-72-35 consensus sequence:-10 consensus sequence (Pribnow box):Shine-Delgarno seque

At 10 sequences and 35 nucleotide sequences upstream from the coding sequence and Shine Dalgarno…

Science

Biology

-35 consensus sequence: -10 consensus sequence (Pribnow box): Shine-Delgarno sequence in the corresponding mRNA: Start (initiation) codon in the corresponding mRNA: Stop (termination) codon in the corresponding mRNA: (label as -35) (label as PB) (label as SD) (label as start) (label as stop) b. What region of this prokaryotic DNA sequence will be transcribed into mRNA? Circle one. 1-120 35-108 54-146 72-146

-35 consensus sequence: -10 consensus sequence (Pribnow box): Shine-Delgarno sequence in the corresponding mRNA: Start (initiation) codon in the corresponding mRNA: Stop (termination) codon in the corresponding mRNA: (label as -35) (label as PB) (label as SD) (label as start) (label as stop) b. What region of this prokaryotic DNA sequence will be transcribed into mRNA? Circle one. 1-120 35-108 54-146 72-146

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 5TYK: Which of the following statements is false? a. GTP is an energy source during various stages of...

See similar textbooks

Similar questions

Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.
Which of the following is not made out of RNA? the carriers that shuffle amino acids to a growing polypeptide strand the ribosome the messenger molecule that provides the code for protein synthesis the intron
A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycine
3. The sequence of bases on an mRNA strand is AAUCGACGCCCGACUAGC. List the codons present in this sequence. 4. List the tRNA anticodons that would pair with the codons present in the above sequence of mRNA. 5. Determine the translated amino acid sequence obtained from the mRNA strand given in question 3. You may use the genetic code table to translate. 6. A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce the codon that will bind it to this anticodon. 7. Explain how you would determine whether a single chain of nucleotides is RNA or DNA. 8. Describe all the elements required to carry out the process of translation. 9. Describe the importance of DNA in determining the structure of a particular protein.
1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…
3. Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNA
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
1) Below are some events that occur in the process of translating mRNA into a protein in a bacterial cell. Pick the best order of events. EF-G–GTP binds to the tRNA in the A site and causes the tRNA to advance to the P site.- The rRNA in the ribosomal 30S subunit base-pairs with the Shine-Dalgarno sequence in the mRNA.- Peptide bond forms between the growing amino acid chain in the P site and the new amino acid in the A site.- IF-3 binds in the E site.- RRF binds in the A site.- RF-1 or -2 binds in the A site.- Ribosomal complex dissociates.- Peptide chain dissociates from final tRNA.- fMET tRNA binds to the start codon in the mRNA.- RF-3–GTP causes displacement of RF-1 or -2 and its exit from the ribosome.- EF-G–GTP binds to the A site and causes RRF to shift to the P site.- A conformational change in the 30S subunit allows the 50S subunit to bind, forming the 70S ribosome. Step 1, 2, 3, 4 ,5 ,6 , 7, 8, 9, 10, 11, 12
1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA codon. State the process used to convert to mRNA and tRNA.
1. Which of the following statements about mRNA is correct?a. Eukaryotic mRNA is generally polycistronic while prokaryotic mRNA is monocistronic.b. Both prokaryotic and eukaryotic RNA is polycistronic.c. Both prokaryotic and eukaryotic RNA is monocistronic.d. Eukaryotic mRNA is generally monocistronic while prokaryotic mRNA is polycistronic. 2. Which of the following statements about leading and lagging strand synthesis is correct?a. The lagging strand can only be synthesized once the leading strand has been completedb. Lagging strand is synthesized is continuously while leading strand is synthesized fragment by fragment.c. Leading strand is synthesized is continuously while lagging strand is synthesized fragment by fragment.d. Okazaki fragments are used to synthesize the leading and lagging strands of DNA. 3. An intron of a gene had a G to T mutation on the 3’ splice site. What will happento this intron?a. The intron will not be spliced out but will not be recognized in the ribosome…
1. Create a DNA sequence with eighteen nucleotides. Indicate its 3’ on the left and 5’ on the right since that’s the template strand you will need in the next question to transcribe the mRNA. 2. Transcribe the DNA sequence above and separate the triplets into codons. Indicate 5’ and 3’ in the correct location on the strand. (Don’t worry about splicing- assume that the pre- mRNA is the same as the mature mRNA sequence) 3. Look at the genetic code, and indicate which amino acid is coded for by the codons in the above mRNA. 4. ANSWER BELOW QUESTIONS: A. First write the original DNA strand. Indicate where the substitution was by either circling it or writing it in a different color. Then write the mutated DNA sequence with the point mutation (aka substitution) wherever you choose for it to be. Again, circle it or write it in a different color. Do the same for the transcribed mRNA. Repeat the directions for 2 and 3 for this new DNA stand. (i.e., include the mRNA and translated protein…
1. Which of the following statements about the flow of genetic information is correct?A. Translation occurs prior to transcription during protein synthesis.B. During translation, the DNA template is converted to amino acids by the ribosomes.C. During transcription, the DNA template is converted to an RNA molecule by the enzyme RNA polymerase.D. Eukaryotic mRNA needs to be transported to the cytoplasm before the protein products are synthesized. 2. What is the main difference in the cell wall composition between eukaryotes and prokaryotes?A. Eukaryotic cell wall is mainly composed on sugar molecules while prokaryotic cell wall has both sugars and amino acids.B. Prokaryotic cell wall is mainly composed on sugar and lipid molecules while eukaryotic cell wall has both sugars and amino acidsC. Prokaryotic cell wall is mainly composed on sugar molecules while eukaryotic cell wall has both sugars and amino acids.D. Eukaryotic cell wall is mainly composed on sugar and lipid molecules while…