4. Questions about Figure 3 (Figure 5 in the paper) below. This was an examination of different pairs of B and y subunits and their ability to localize to the plasma membrane. A В C YN-B,YC-Y1 YN-B YC-Y7 YN-B,YC-Y2 YN-B2YC-Y7 YN-B2YC-Y2 YN-B,YC-Y 2 YN-BYC-Y7 YN-BYC-Y2 YN-BSYC-y LL I

Q: Based on what you know about the structure of GPCRs, they must have: a)One internal start transfer…

A: Proteins destined for secretion outside the cell or lumen of an organelle are first targeted to the…

Q: Describe the roles of p53 and NFAT and their nuclear import. How does the phosphorylation regulate…

A: Introduction :- A family of transcription factors known as nuclear factor of activated T cells…

Q: 1. Peroxisomes are organelles surrounded by a single membrane. Soluble proteins that reside within…

A: Answer a)  If we do mutation at the c terminus skl tripeptide signal sequence then this protein will…

Q: Explain the steps associated with translocation of ER proteins across the ER membrane.

A: The Endoplasmic reticulum(ER) plays an important role and it would be the place where the membranes…

Q: After the initial Actualization of the Cit+ phenotype, there was another alteration to the A-3…

A: Bacteria are dynamically evolving microbes. Various experiments suggest the evolution process of…

Q: if there were two amino acid signal sequences were expressed on a aingle protein. where should the…

A: *Cells have various transport systems to make sure that proteins arrive at their correct…

Q: 16b) Suppose you have a cell in which the Iron Response Factor (IRF) protein is mutated so that it…

A: Iron is a trace element in our body, which is very important to produce hemoglobin which carries…

Q: The first 32 amino acids from the N terminus of the protein bovine angiogenin were determined by…

A: Protein Sequence First of all we need to understand where chymotrypsin act, which bond (peptide…

Q: Proteins that are retained in the ER have a KDEL sequence at their C-terminus.  To test the idea…

A: Protein disulfide isomerase,, is an enzyme in the endoplasmic reticulum (ER) in eukaryotes that…

Q: Briefly describe the following properties of the Ras GTPases: a) Size, structure and cellular…

A: a) Mature ras protein are located on the inner side of the plasma membrane, and their biochemical…

Q: How many ATP and GTP molecules would be hydrolyzed in the synthesis of a 125 amino acid protein?…

A: ATP and GTP provide signals to drive many cellular functions.

Q: When the amino acid levels in eukaryotic cells are low, general protein synthesis is reduced. Gcn4…

A: Gcn4 is a transcription factor, also a master regulator for gene expression. It regulates about…

Q: Ribosomes markedly accelerate thehydrolysis of GTP bound to the complex of EF-Tu and aminoacyltRNA.…

A: Introduction GTPases are regulatory molecular switches in various cellular machinery involving a…

Q: Transcriptional regulators are proteins that bind to promoters (at the 5’ flanking regions of genes)…

A: Transcription is the synthesis of mRNA from DNA template with the help of RNA polymerase and many…

Q: Members of the integrin family are the major cell surface receptors for many ECM proteins such as…

A: Integrins are a family of αβ heterodimers. Integrins are cellular adhesion receptor molecules that…

Q: When the amino acid levels in eukaryotic cells are low, general protein synthesis is reduced. Gcn4…

A: Protein synthesis is the process in which cells make proteins. It occurs in two stages of…

Q: Predict and explain the effect on GAL1 transcription, in the presence of galactose alone, of the…

A: Note: Hi! Thank you for the question. As per the honor code, we are allowed to answer three…

Q: EF-Tu, a member of the G-protein family, plays a crucial role in the elongation process of…

A: Protein synthesis is a process through which genes in the DNA are transcribed into mRNA and through…

Q: While each G-protein subunit has a distinctly characteristic C-terminal sequence that binds certain…

A: G-protein coupled receptors are heteromeric transmembrane proteins. GPCR is activated by specific…

Q: Although Ribosome binding site sequence vary considerably in different genes, they include examples…

A: Ribosome binding site (RBS) includes a sequence of nucleotide, which are present upstream the…

Q: Polypeptides with the ER Signal Sequence (MMSFVSLLLVGILFTATEAEQLTKCEVFQ <- one-letter amino acid…

A: Proteins are synthesized in the cytosol in a process called translation. RNA polymerase and other…

Q: Notch is an important transmembrane receptor that is present on the plasma membrane. Curiously, it…

A: Introduction When Exposed To Light In The Blue To Ultraviolet Range, The Green Fluorescent Protein…

Q: If a new isolated protein called STICKY and this STICKY protein contains a bHLH domain. Now, how we…

A: Protein motifs are the distinct conserved small polypeptide sequence in proteins. These super…

Q: Melanosomes are specialized lysosomes that storepigments for eventual release by exocytosis. Various…

A: Introduction Melanosomes are organelles that produce and store melanin, a common biological pigment…

Q: Briefly describe the following properties of the Rab and Arf GTPases: a) Size, structure and…

A: Hi, thank you for posting the question on Bartleby. As per the guidelines, we can answer only one…

Q: Describe the general function and structural features of G-protein-coupled receptors (GPCRs). Be…

A: G protein coupled Receptor is also called as serpentine receptor that has 7 transmembrane folds.…

Q: EF-Tu, a member of the G-protein family, plays acrucial role in the elongation process of…

A: Translation or protein synthesis is the process by which the genetic information from DNA is passed…

Q: Ribosomes markedly accelerate the hydrolysis of GTP bound to the complex of EF-Tu and aminoacyltRNA.…

A: GTPases are the large family of hydrolase enzymes that bind to the GTP and hydrolyze it to GDP. The…

Q: Examination of the histone modifications of a gene reveals an abundance of histone H3 with lysine 27…

A: This gene is likely activated since the mono-methylation of the lysine residue at position 27 in…

Q: A recent genome sequencing project for the bacterium Burkholderia mallei has identified a new…

A: The new protein identified here has a partial sequence given as TVEVNAPGDVQKALSELQQINDGRLDIRI…

Q: Specificity in fusion between vesicles involves two discrete and sequential processes. Describe the…

A: Enzymes are biocatalysts that aid in the acceleration of the reaction. They are proteins that serve…

Q: The three amino acids "DRY" in loop I2 are required for protein targeting. What is the name of this…

A: Hello! Since you have posted multiple questions, we are answering only first question. If you need…

Q: Thousands of caspase substrateshave been identified. Which onesare the critical proteins that mustbe…

A: Introduction Apoptosis is known as programmed cell death. Whenever there are any lethal chromosomal…

Q: Mhich of the following polypeptides is coded for my the MRNA sequence 5' AUGGUUAAACGACAAUCC 3 ?

A: The amino acids are selected and wrote in the sequence as first, second and third base. The process…

Q: If you were to remove the ER retrieval signal fromprotein disulfide isomerase (PDI), which is…

A: We got the information of first type in carboxyl terminus of soluble ER proteins and in golgi…

Q: Signal-transducing heterotrimeric G proteins consist of three subunits designated α, β, and γ. The…

A: GPCRS are the largest family of cell surface receptors that transduce signals to intracellular…

Q: a. Would you expect a cell to continue or to stopdividing at a nonpermissive high temperature if…

A: The normal genes have various forms that can grow normally at low temperature and have an abnormal…

Q: and Arg29 is important in determining the structure of the protein. a) What type of amino acid is…

A: This is a question about protein fold and the importance of amino acids in folding.

Q: Expression of the muscle specific protein dystrophin is important in the functional formation of…

A: Dystrophin is a protein which is essential for the proper contraction of muscles and it is found…

Q: Comparison of 1IR3 and 1IRK shows that the tyrosine kinase domainfrom dimer, and that the…

A: insulin receptors are the transmembrane receptors they are activated by the insulin they belong to…

Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation,…

A: This is a nucleotide sequence of a DNA as it contains four types of nitrogenous bases Adenine,…

Q: Describe the importance of ubiquitin-dependent degradation of soluble proteins.

A: Thousands of distinct proteins are found in all living cells, each of which performs a specific…

Q: When the amino acid levels in eukaryotic cells are low, general protein synthesis is reduced. Gcn4…

A:

Q: Which factor has NOT been shown to play a role in determining the specificity of protein kinases?…

A: The protein kinase is an enzyme associated with the phosphorylation of protein by adding phosphate…

Q: What type of regulation does the interaction of BPG with hemoglobin represent?

A: 2, 3-Bisphosphoglycerate (2,3-BPG) is most abundant organic phosphate in the red blood cell. Molar…

Q: Why is it important that the approximately 60 different Rab GTPases in humans are associated with…

A: Rab GTPases-It is the main regulator of eukaryotic membrane transport. GTPases-Guanine…

Q: membrane-associated protein kinase has the sequence -GMCLVS at its C-terminus, which  has been shown…

A: Mutagenesis is the process by which the change in the DNA of an organism results in the mutation of…

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.