4. What are things we have to consider when collecting blood using anticoagulated tubes? blood sample should be mixed right after collection pediatric tube can be used if the adult patient vein is difficult to draw the ratio of blood and anticoagulant can be adjusted all of the above

4. What are things we have to consider when collecting blood using anticoagulated tubes? blood sample should be mixed right after collection pediatric tube can be used if the adult patient vein is difficult to draw the ratio of blood and anticoagulant can be adjusted all of the above

Body Structures & Functions Updated

13th Edition

ISBN:9780357191606

Author:Scott

Publisher:Scott

Chapter12: Blood

Section: Chapter Questions

Problem 5ATC

See similar textbooks

Related questions

Q: Is the seedling shown on the right a monocot oreudicot? How can you tell?

A: An embryonic shoot and a root can be found inside a seed. While the cotyledons are linked to the…

Q: Why is a weed significant as a pest?

A: Introduction Pest:- It is defined as a living organism, either an animal, fungus, or plant that is…

Q: Describe the unique way that auxin can move through a plant.

A: Auxins are a type of plant enzyme that resembles morphogens in some ways. Auxins are important for…

Q: Question How does the female reproductive system protect itself from pathogens?

A: Pathogen It is defined as the organism that have the ability to cause a disease. The microbes cause…

Q: Study the diagram below. Put the number of the step in the diagram by its description in the list of…

A: Restriction DNA technology can be defined as a set of techniques ; in which DNA is identified DNA;…

Q: Match the following scientists who emerged in specializedfields of microbiology to their famous…

A: Introduction :- Virology is the study of viruses and virus-like entities, which are submicroscopic…

Q: Question - What is biology? A) The study of DNA. B) The study of the environment. C) The study of…

A: Question - What is biology? A) The study of DNA. B) The study of the environment. C) The study of…

Q: Indicate whether each of the following statements is true (T) or false (F). a. An unsubstantiated…

A: A virus is an infectious microbe consisting of a segment of nucleic acid (either DNA or RNA)…

Q: nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter…

A: The genetic code is the relationship between the sequence of bases in DNA and the sequence of amino…

Q: write in one or two sentence for each please. Define the following terms: a. biotechnology:…

A: Introduction Biology:- It is a branch of science that deals with living organisms and their vital…

Q: QUESTION 32 Consider the recombination frequencies data below from a series of two-point crosses…

A: The linkage group has linked genes. These genes stay together during the process of gamete…

Q: You are studying a type of bacteria isolated from the acidic water runoff of a mining operation. You…

A: Introduction Blotting procedures are used to transfer nucleic acids from gels to membranes for…

Q: What are the two body dysfunctions of an animal in the order DECaPODA?

A: decapod order Decapoda any of more than 8000 species of crustaceans phylum Arthropoda that include…

Q: can you please explain the last part of step 2 further? Specifically this "The complementation…

A: Complementation is a relationship between mutations in an organism that helps us determine that the…

Q: How would you devise a screen to identify recessive mutations in Drosophila that result in embryo…

A: Fruit flies, or Drosophila melanogaster, are a good model for studying genetics and were chosen by…

Q: Describe the contributions of the following scientists to thefield of microbiology: Beijerinck,…

Q: All of the following statements about polioviruses are correct except _____. a. Poliovirus…

A: Poliovirus is the causative agent of poliomyelitis, also known as polio. It is a human enterovirus…

Q: Explain auxin’s effect on growth and how it causes plant cellsto enlarge.

A: Plants naturally produce auxins, a potent growth hormone. They promote cell division, stem and root…

Q: 8. If the molecular weight of E. coli DNA is taken as 2.7 x 10° and the average molecular weight of…

A: Nucleic acids are essential for all forms of life and are found in all cells. Nucleic acid comes in…

Q: Describe how the bird populations will most likely change if a severe drought were to occur for a…

A: Bird populations will major change if a severe drought were to occur for a four-year period in…

Q: The job of a ribosome is to: make an mRNA transcript of DNA synthesize a new strand of DNA using the…

A: INTRODUCTION Protein synthesis is the process in which the formation of new proteins takes place. In…

Q: Identify two ways in which the immune responses in gut mucosal tissues contrast with those initiated…

A: Mucosal tissues are found in the body as plasma cells, which are mostly found on epithelial…

Q: Using the data gathered by the instructor from other students in University, calculate the…

A: Given information Free-hanging earlobes (F) is dominant Attached earlobes (f) is recessive Total…

Q: Use a phenomenon to explain how materials (water, glucose, oxygen/carbon dioxide) pass thru the cell…

A: Introduction The movement of materials across cell membranes is known as cell transport. Passive and…

Q: describe the likely pathway a dsRNA takes after being eaten in order for an RNAi effect to be passed…

A: The dsRNA enters the cells as the embryo develops. Through all stages of development this method…

Q: How would you determine the sugar-binding specificity of any isolated lectin?

A: .Lectins are the specialised proteins that may bind to a specific carbohydrates present on the…

Q: What about Phloem?

A: Plants, of course, do not absorb food in the same manner that humans do. Rather, while…

Q: 100 Amo unla tissu 80 capi 60 40 Systemic arterial Po2 Systemic venous 20 Po2 40 60 80 100 1 20 (%)…

A: Hemoglobin is the main protein in the red blood cells. its main function is to carry oxygen to the…

Q: Why is a strong reducing agent, such as NaBH4, not suitable for use in the conjugation of an…

A: The NaBH4 is a strong reducing agent and can reduce aldehyde, ketones and the acid chlorides into…

Q: One objection many people have about vaccinations is the amount and variety of chemicals in them.…

A: Vaccination is a simple, safe and effective way of protecting you against harmful diseases. It uses…

Q: VARIATION IN POPULATION DENSITY OF BEETLES 40 35 30- Species A Species B Species C 25 20- 15 10- 5…

A: Population density: Population density is actually the concentration or total number of a particular…

Q: catalyzes the reaction that creates creatine phosphate in skeletal muscle A Creatine phosphatase…

A: Creatine phosphate is the main high-energy, phosphate-storage molecule of muscle.It is primarily…

Q: 2. The endosperm of maize can either be yellow of White. with two alleles, Y has yellow endosperm…

A: INTRODUCTION The endosperm is the tissue that surrounds and nourishes the embryo in angiosperm seeds…

Q: 5. Define the different system based on the discussion.

A: Introduction The human body is the physical structure of a person. It is made up of a variety of…

Q: Whereas _____ is the predominant immunoglobulin in intestinal fluid, _____ is the dominant…

A: Cell is a simple machine that houses all of the essential organelles required for life's sustenance.…

Q: With regard to the characteristics and replication of HIV discuss reasons why the virus is so…

A: ANSWER) It is very difficult to produce vaccine against the Human immunodeficiency virus as the…

Q: Which statement of the cell theory is connected to an understanding of meiosis? Cells are the basic…

Q: Describe the agar-overlay technique

A: Biological techniques are methods or processes used to study living things. Methods, approaches,…

Q: What are the legal risk of Ethical, Legal and Societal Implications (ELSI) of GMOs

A: Genetically modified organisms are those in which genetic engineering techniques are used to alter…

Q: The muscle cell membrane of the neuromuscular junction is called the A. Synaptic cleft B. Motor end…

A: Introduction The neuromuscular junction (NMJ) is a highly specialised synapse that connects a motor…

Q: bacteria

A: Auxotrophic strains lack the ability to synthesize one essential compound for example amino acid.…

Q: Compare and contrast the action of DNA damaging agents that lead to: 1. Point mutations . 2.…

A: 1. Point mutation... Point mutation is the single nucleotide mutation in DNA. In this mutation…

Q: Distinguish between catabolism and anabolism.

A: Metabolism refers to the chemical events that take place in the cell to produce energy. The acquired…

Q: Describe the probable root system of a crop that has been applied with frequent and light

A: Given: Need to describe the probable root system of crop that must be applied Frequently and in…

Q: onsidering the number of base pairs, compute for the actual length (in micrometers) of this DN

A: There are 7 base pairs. Length of one base pair is 3.4 Angstrom. Length of 7 base pairs is 3.4 X 7=…

Q: Members of Suliformes typically lay 2-3 eggs, but it is rare that more than one nestling survives.…

A: Introduction:- *The Suliformes is a recognised order by the Ornithologist Union. * In light of…

Q: QUESTION 3 Considering the genotypes for the ABO locus and the H-locus of the patient below, what…

A: The ABO blood group is depends on the presence of specific antigen on the plasma membrane of RBC or…

Q: Any change in WT DNA sequence without any phenotypic appearence Mutant Mutation Genotype Phenotype

A: Any change occurs in wild type DNA sequence is called mutation.

Q: potential ways that organisms can respond to rapid changes to their environment, such as can result…

A: Adapting the climate change Adaption is a strategy to survive better and combat with chàllamges in…

Q: The gene ABCD is 1500 bases long. Answer the following questions: What would be the likely…

A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…

Concept explainers

Health Assessment

Question

100%

Check all that applies

4. What are things we have to consider when collecting blood
using anticoagulated tubes?
blood sample should be mixed right after collection
pediatric tube can be used if the adult patient vein is difficult to
draw
the ratio of blood and anticoagulant can be adjusted
all of the above

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Introduction

VIEW

Answer

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

7. Which of these is the best time to draw (collect blood) A. Right before the next dose B. When the level of the medication is at its highest C. During surgery D. After the second dose is administered IV
A blood transfusion is being set up in an emergency room for an accident victim. Blood has a density of 1060 kg/m3 and a viscosity of 4*10^-3 Pa.s. The needle being used has a length of 3 cm and an inner radius of 0.25 mm. The doctor wishes to use a volume flow rate through the needle of4.5*10^-8 m3/s. What is the distance h above the victim’s arm where the level of the blood in the transfusion bottle should be located?
1. I - The needle cannot penetrate the vein if the needle is not inserted enough. II - In cases of the needle that completely through the vein, tissue juice may fill into the tube A. The FIRST statement is CORRECT, and the SECOND is WRONG. B. The FIRST statement is WRONG, and the SECOND is CORRECT. C. BOTH statements are CORRECT. D. BOTH statements are WRONG. 2. I - Re-palpation is only applicable when the needle location is undetermined. I - Probing is the correct way to remediate this. A. The FIRST statement is CORRECT, and the SECOND is WRONG. B. The FIRST statement is WRONG, and the SECOND is CORRECT. C. BOTH statements are CORRECT D. BOTH statements are WRONG. 3. I - Heparin gel-barrier tubes should allow cells to settle before centrifugation. II - Gel barrier serum tubes may be centrifuged right away after blood extraction since a gel barrier and clot activator is present. A. The FIRST statement is CORRECT, and the SECOND is WRONG. B. The FIRST statement is WRONG, and the…
2. The order written by physician is for Mrs. Winters is to receive one dose of Mucomyst 300 mg by mouth before heart cath. Pharmacy sends 600mg/2ml. How many ml will you administer per dose? 1 ml was wrong answer
An IV is set to infuse at 45 mL/hr. At 6:00 pm there are 310 mL remaining in the bag. At what time should the IV be finished?
When administering a cytotoxic agent through the direct IV push method, the nurse: A. allows for compatible IV solution to flow freely. B. flushes the line with sterile solution before administration. C. attaches the syringe to the injection port farthest from a patient. D. aspirates for blood returns every 2 – 5 ml
1. Which of the following lab results would indicate high risk for atherosclerosis ? A. 100 mgLDL / 100 mL of blood B. 180 mg HDL / 100 mL of blood C. 60 mg HDL / 100 mL of blood D. 200 mg LDL / 100 mL of blood
4. A tourniquet is used by the phlebotomist to assess and determine the location of a suitable vein for venipuncture. Explain briefly:a. Why the tourniquet should be applied prior to blood withdrawal b. Where the tourniquet should be applied before blood can be withdrawn.
1. The physician orders 1 unit (270 mL) of PRBCs to infuse 1.5 hours.A. How many mL will the patient receive per hour?B. The nurse uses a blood tubing labeled 10 gtt/mL. What is the flow rate?
Since 1400, your patient has had medication given through her NG tube at 2000. The Dilantin was 35mL. The multivitamin was 15mL and the Lasix was 10mL. Between each medication and after the last medication, there was a 30mL flush of water. At 1600, she was given 150mL of free water. Her IV was infusing @ 83mL/hour for 8 hours since the last I&O was done. Her Foley output is 675mL and her flexiseal output is 220mL. What is her I&O for 2200?
1. what is the main disadvantage of gravity-based infusion device? please explain it 2.wht does a sleep apnea do? and what types of measurement this device can do?
4. A young adult comes to an outpatient lab to have his blood drawn. The phlebotomist refuses to draw this patient’s blood because the patient?:a. does not have insurance, but offers to pay cash.b. has never had his blood drawn before this time.c. has not reached the age of majority in the state.d. has not eaten breakfast and feels light-headed.