Q: The hydrolysis of ATP requires a. energy. b. water. C. a high temperature. d. energy and water. e.…
A: Answer is.. Water (b)
Q: What are the functions of ovaries in a flowering plant?? A. TO PRODUCE FEMALE GAMETES B. TO PRODUCE…
A: ovary, in flowering plants is enlarged basal portion of the pistil, the female organ of a flower.
Q: Describe how biodiversity contributes to the sustainability of an ecosystem.
A: Biodiversity refers to the variety of life that may be found in a given flora and fauna and even…
Q: Which of the following methods should NOT be used to thaw frozen meats? a) refrigerator thawing b)…
A: Thawing is the process of taking a frozen product from frozen to a temperature (usually above 0°C)…
Q: One of the challenges faced by animals when moving from an aquatic environment to a terrestrial…
A: Name- Dolphin, Phylum it belongs to - Chordata . Adaptations- structural adaptations- they have…
Q: How many amino acids would there be in the protein produced from the following mRNA molecule ?…
A: 1. Stop codons- UAA, UAG and UGA. Codon consists of 3 nucleotides. There are 11 codons, but 10…
Q: In the evolutionary tree, sexual reproduction first appeared in which group of organisms? plants…
A: Answer
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A: DNA contains the genetic information about the characteristics features of te organism present in…
Q: QUESTION 8 The mating below shows the sex chromosome found in two parents and their resulting…
A: The fragile X mental retardation protein is encoded by FMR1, which is found on the X-chromosome…
Q: European cuckoos and North American brown-headed cowbirds are not close relatives, but both lay…
A: Animal behavior is heavily influenced by the environment to which it belongs. If they do not fit in,…
Q: What is the difference between endergonic andexergonic chemical reactions?
A: A chemical reaction is the transformation of one or more reactants into one or more products.…
Q: QUESTIUN 12 Consider the arrangement of the following four normal chromosomes from some hypothetical…
A: The centromere is involved in an inversion of a chromosomal fragment, and splits happen on both arms…
Q: Scientists discovered a new species of frog and were able to estimate its population at 755…
A: In ecology, we study the interactions that take place between the different organisms and their…
Q: Whereas _____ is the predominant immunoglobulin in intestinal fluid, _____ is the dominant…
A: Cell is a simple machine that houses all of the essential organelles required for life's sustenance.…
Q: bacteria
A: Auxotrophic strains lack the ability to synthesize one essential compound for example amino acid.…
Q: Name and describe the two forms of energy and provide an example of each.
A: According to science , energy is the quantitative attribute that must be transmitted to a body or…
Q: Distinguish between What is known of CD105 (endoglin) as an hepatcellular carcinoma marker and it’s…
A: There are few points that should kept in mind : A molecular or DNA marker is defined as a…
Q: Members of Suliformes typically lay 2-3 eggs, but it is rare that more than one nestling survives.…
A: Introduction:- *The Suliformes is a recognised order by the Ornithologist Union. * In light of…
Q: How can one cell give rise to different types of cells? Support your explanation with embryologic…
A: Introduction A cell is a cytoplasmic mass that is outwardly bound by a cell membrane. Cells are the…
Q: 2. Consider genes that have 2 alleles each. Gene 1 has allele "E" and "e", where E is dominant to e.…
A: A dihybrid test cross is a cross between a double heterozygous individual and a double homozygous…
Q: 5. 5. Draw a phylogeny the following taxa: shark; tuna; frog; lizard; mouse; whale. On your…
A: Evolution solved the challenge by developing the cellular differentiation process, which resulted in…
Q: in certain fish the mating of black-scaled (B) with white a white-scaled (W) will create offspring…
A: Introduction :- Fish are aquatic vertebrate animals having gills but no digits on their limbs, such…
Q: Consider a diploid organism that follows the XX-XO mode of sex determination. Normally, there are 7…
A: Given data, Number of chromosomes present = 7 Chromosome I = large acrocentric chromosome…
Q: In this scenario, we'll be discussing the Xtina gene, which encodes the Xtina protein. Xtina is…
A:
Q: To explain: The defining characteristics of adaptive immunity.
A: Adaptive Immunity: The adaptive immune system, also known as the acquired immune system, is a…
Q: Question - How does the female reproductive system protect itself from pathogens?
A: Female reproductive system is highly protected from pathogen invasion,
Q: 2. Consider the following paragraph from a peer-reviewed publication detailing the extraction and…
A: Lectins These are defined as glycoproteins. They have the ability to make bonds with carbohydrates…
Q: MECHANISMS EXAMPLES 1. 1. Geographical Isolation 3. 1. 2. 2. Temporal/Seasonal Isolation 1. 2. 3.…
A: Temporal isolation is when species that could interbreed do not because the different species breed…
Q: To determine: A defining characteristic of the innate immunity.
A: The ability to remember is the most noticeable feature of the immune system. Memory is an important…
Q: Please discuss the value of international normalized ratio (INR) as a test. Why do you think this is…
A: PT test is the normal blood test conducted to record the time taken for blood to clot.
Q: XBT is a gene that controls the development of the body, specifically by determining the number c…
A: Answer: Toolkit gene These genes regulate the embryonic developments. They are involved in central…
Q: A survey was conducted for a certain trait (the ability to roll tongue or inability to roll the…
A: Introduction Hardy-Weinberg equilibrium:- It states that the genetic variation in a population will…
Q: Describe the proximity in time, similarity in timbre, pitch and good continuation? How are these…
A: Sound is defined as the vibrations that travel through the air or another type of medium as an…
Q: Here is a family pedigree for an imprinting disorder caused by a loss of function mutation in a…
A: A) In the pedigree chart we can see that : Carrier father can pass on the genetic defect to his…
Q: What is carotenoids, carotenes and xanthophyll? Why these compounds are important in human diets?
A: Introduction Photosynthesis is the process through which green plants and other organisms use light…
Q: 1. Name the receptor indicated by the arrow labeled A. 2. What specific layer of the skin is…
A: 1. Meissner's corpuscle They contain a cutaneous nerve ending responsible for transmission of…
Q: a catabolic process.
A:
Q: It has been established that V. parahaemolyticus cross-reacts with many marine bacteria…
A: Serological tests signify those tests, that detect the antibodies against a microorganism. It…
Q: 2. Next, use the Hardy-Weinberg equation (p + 2pg + g = 1) to calculate the expected frequencies of…
A:
Q: is this true or false?
A: Human evolution is defined as "the process by which humans evolved on Earth from now-extinct apes."…
Q: The structure of a lipid bilayer is determined by the particular properties of its lipid molecules.…
A: The plasma membrane's basic structure is a lipid bilayer, which is made up of two leaflets of…
Q: Activity 1: Research 5 similar species with different characteristics. Example: Gartner snakes live…
A: An organism's "niche" is defined by the collection of circumstances, supplies, and relationships…
Q: Multicellular organisms exhibit a hierarchy of cellular organization. The diagram below shows four…
A: On a scale of small to enormous, living beings are highly organized and arranged in a hierarchy. As…
Q: All of the following contribute to the establishment and maintenance of long-lived memory B cells…
A: B cells are lymphocytes which are important for the adaptive immune system's humoral defense…
Q: B. The illustration shows the stages of development in human embryo. 2 CELL EGG 4 CELL EGG…
A: Introduction Life starts from single cell called zygote. Zygote is single diploid cell resulted…
Q: The following graph depicts the relationship between the mean flower depth of Zaluzianskya…
A: Introduction Evolution is the process of a species' features changing over numerous generations…
Q: All of the following are generated directly during the Krebs (TCA) cycle except? a. ATP b. GTP c.…
A:
Q: Calcitonin is enzyme that functions to reduce blood calcium levels
A: Calcium may be a mineral that's found in a very form of foods. calcium is needed by the body to take…
Q: Gestation takes about -____weeks. a) 38-42 b) 44-46 c) 28-30 O d) 48-52
A:
Q: explain two ways in which to lessen or avoid the development of insect resistance to the Cry protein…
A: Introduction Insecticide resistance is a heritable modification in a pest population's…
Summarise in words the information presented in the graph.
Step by step
Solved in 2 steps
- Plot survivorship curves for all three species illustrated in Table 1 on a single graph. Label the axes and provide a clear legend convert it and make use of legend, so for the first species it would be 6months=1unit, then for the second species 1yr=1unit, and the third species would be 50yrs=1unitDescribe the mechanisms by which human population growth and resource use causes increased extinction rates.The per capita growth rate of a population where dispersal is not a factor is expressed as (a) i + e (b) b d (c) dN/dt (d) rN(K N) (e) (K N) K
- Date Juncos previously banded (r) Captured, already banded (r) Captured, new individual Total number captured on that date (s) Estimated population size (N) 11-Jan 39 14 9 16 - Jan 48 4 7 23 - Jan 55 2 8 30 - Jan 63 8 2 6 - Feb 65 6 5 Complete the table by following the Mark Recapture Formula.Two species have the same initial population size of 48.00, as well as rates of b = 0.83 and d = 0.66. However, species A reproduces seasonally and species B reproduces relatively continuously. How much bigger would the population of species B be after five years as compared to species A?Population size increases whena. the sum of birth rate and death rate exceeds the sum ofimmigration and emigration.b. the sum of birth rate and immigration exceeds the sum of deathrate and emigration.Figure 37.20 Opportunistic and Equilibrium Species:A Summary.• High reproduction rate• Many o spring• Each o spring receives littleparental care• Low survival rate for juveniles• Early reproductive maturity• Type III survivorship curve:Opportunistic life history Equilibrium life history• Low reproduction rate• Few o spring• Each o spring receivesextensive parental care• High survival rate for juveniles• Late reproductive maturity• Type I survivorship curve:AgeSurvivorsAgeSurvivors764 UNIT SEVEN The Ecology of Lifehoe2420X_ch37_748-765.indd 764 12/15/16 11:45 PMc. the sum of birth rate and emigration exceeds the sum of death rateand immigration.d. the sum of death rate and immigration exceeds the sum of birthrate and emigration.
- Plot a survivorship curve for a species with high rates ofpredation early in life and one for a species with high mortalitylate in life. Name the types of survivorship these speciesdisplayUsing the life table: a) what is R0 for this population? b) Based on R0 from your previous answer, is this population :growing, stable or declining? c) what is the most likely survivorship curve for this population? type 1, 2, or 3?A species is considered to be endangered if it is expected to be extinct within 20years. A population of porpoise has approximately 1, 150 members alive today, and thepopulation has been steadily declining at an annual rate of about 36% over the pastdecade. In what year is the population expected to have only 1 individual left alive?Should this species of porpoise be considered endangered?
- Using the logistic equation, calculate population growth when K =1,000, N = 100, and r = 0.1. Compare the result with that shown inSection 56.3, where K = 1,000, N = 900, and r = 0.1, and with theresult when K = 1,000, N = 500, and r = 0.1.Assume that the population of the greater roadrunner in the Guadelope Desert was 250 per hectare at the beginning of 1999. If the carrying capacity, K , is 750 and r=0.25 per year, what is the number ofroadrunners: (a) after a year later, (b) ten years later, (c) after a score, (d) a century later, and (e) a millennium later?A student decides to use the mark-recapture technique to estimate thepopulation size of mosquitofish in a small pond near his home. In thefirst catch, he marked 45 individuals. Two weeks later, he captured 62individuals, of which 8 were marked. What is the estimated size of thepopulation based on these data?a. 134 c b. 349 c. 558 d. 1,016 e. 22,320
