Please answer all the questions. I'll definitely give a like. 4. When discussing mismatch repair and base repair mechanisms:a. Compare and contrast the two mechanisms. Which processes are similar? Which are different?b. In order to corect mistakes/damage during both processes, the complementary strand is used as atemplate. If mismatches or damaged bases 'nucleotides were repaired without regard for which strandserved as template, how would this impact DNA? Explain your answer.

DNA repair is defined as a set of mechanisms ;by using which cell is able to repair the DNA…

Answered: 4. When discussing mismatch repair and…

4. When discussing mismatch repair and base repair mechanisms: a. Compare and contrast the two mechanisms. Which processes are similar? Which are different?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 12TYK: Discuss Concepts A forensic scientist obtained a small DNA sample from a crime scene. In order to...

See similar textbooks

Related questions

Q: Explain why are errors in DNA replication so rare, what enzymatic activity, in addition to…

A: DNA replication: Transmission of chromosomal DNA from generation to generation is achieved when DNA…

Q: 1. What does PCR allow you to do with DNA?

A: The separated and identified PCR results are then used to characterize the STR region under…

Q: How are Recombinant DNA formed?What is the difference between genetic modification and selective…

A: Recombinant DNA technology is a new approach to modify the genome of a host organism by joining two…

Q: 3. What is a restriction digest? What does it mean if you were given a precut DNA? 4. What is…

A: Restriction digest It is the process of cutting DNA molecules into smaller pieces with special…

Q: 1- Explain genetic transformation of bacteria and significance of the bacterial transformation for…

A: Transformation is the process of uptake of naked DNA from the environment by bacteria. It is a type…

Q: 4. What makes the genetic modification of corn and bacterial cells similar to each other?

A: 4th Answer

Q: 3. What is the fimbrae and its function? 4. What does the plasmid contain the code for?

A: Fimbriae have a significant part in pathogenesis by permitting colonization of explicit tissues by…

Q: . Which of the following statements about the flow of genetic information is correct? A. Translation…

A: Genes are the basic hereditary molecules that carry hereditary information in them. They are present…

Q: 1. Determine what is being meant by the statements: a. What is a binary vector? What characteristic…

A: A vector is a DNA molecule that is used in molecular cloning to intentionally transport foreign…

Q: 5. If you are able to successfully incorporate foreign DNA to your host organism, what are your…

A: A foreign DNA is a DNA that is transferred into a species from other source and not that of parent.

Q: 1.Make a flow diagram to describe each of the prokaryotic DNA repair mechanism 2. Give 2 examples of…

A: DNA repair is a constant process in the cells where the damage is repaired. The cell contains a…

Q: Provide a detailed description and hand drawn figure of each of the following. (1) Mismatch…

A: Although the genetic variation is important for evolution, the survival of the individual demands…

Q: be beneficial or harmful? Explain your answer 2. Distinguish between spontaneous and induced…

A: Abrupt changes in the DNA sequence that may or may not change the amino acid sequences in a protein…

Q: 2. How does the P-tube differ from the P+ tube? X P- has a control plasmid added to it that does not…

A: Difference between the P + and P - tubes are the bacteria in P+ tube were given plasmid and bacteria…

Q: 6. Two possible paint mutations are the substitution of lysine for leucine or the substitution of…

A: Every physiological characteristic or metabolism of our body mainly controlled by proteins. These…

Q: Give 2 advantages of SPACER DNA SEQUENCES as regions in the genome/chromosome to target for DNA…

A: "Biotechnology" is the use of our knowledge of biological processes to the development of beneficial…

Q: 3. Explain the differences between a point mutation and a frameshift mutation.

A: Mutation - A mutation is the condition during which there is any damage to the gene / DNA as a…

Q: 1. Which of the following terns refers to both the movement of a ribosome along a piece of MRNA and…

A: A karyotype test examines the size, structure, and amount of chromosomes in your body. The sections…

Q: 7. The cloned gene of interest is inserted where in the Ti plasmid? A. just prior to the T-DNA B.…

A: Recombinant DNA (rDNA) is a technique that employs enzymes to cut and paste back DNA sequences of…

Q: . Illustrate the basic steps in DNA extraction

A: The genetic material that is densely packed inside the nucleus and chromosomes is known as DNA. The…

Q: 1.a How does a cell recognize which strand is the sense strand? b. How does the RNA polymerase…

A: One of the important process in central dogma. It is a process of making a RNA copy using DNA; it is…

Q: 6. Assume that you are working at a biotechnology company and you are assigned to a project in which…

A: Protein purification is a set of procedures for isolating a single or a few proteins from a…

Q: 1. A new drug was developed to inhibit RNA transcription of a new strain of bacteria infected in…

A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…

Q: 1) Recombinant DNA technology and selective breeding are 2 techniques that seek to produce desirable…

A: WHAT IS RECOMBINANT DNA TECHNOLOGY AND SELECTIVE BREEDING ? - Recombinant DNA technology simply…

Q: 1. What is the purpose of recombinant DNA technology?

A: Since you have posted multiple questions, we will do one question for you. If you need any specific…

Q: Why is the TP53 called the guardian of the genome?

A: Genome The genome of an organism consist of whole genetic material. The both part of gene coding…

Q: 3. What do you think happened? How do you explain this result? Your supervisor gives you an E.coli…

Q: What is the difference between a synonomous and non-synonomous mutation? What is another name for…

A: Mutation may be defined as a sudden or abrupt change in the DNA sequence due to cell…

Q: What is the mechanism of action of ultraviolet radiation in bacterial mutation?

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: 3. Explain in your own words the methods used to collect your cheek cells and to extract the DNA. Be…

A: DNA extraction

Q: 9. Explain why DNA fragments move through a gel at different rates. (A2)

A: A technique called gel electrophoresis is used to separate DNA fragments (or other macromolecules,…

Q: 1.Photoreactivation is called a direct reversal of DNA damage. Mismatch repair, Nucleotide excision…

A: The presence of mutation in the genome gives rise to genetic variations. These variations are…

Q: 4. Draw the actual map of the PMBBS plasmid, following the style of the sample map shown in Figure…

A: Restriction enzymes: Restriction enzymes are also called molecular scissors. These are named so…

Q: 7. Why recombinant DNA is very useful in improving our health conditions? A. Human insulin can be…

A: Of the many advancements in biotechnology, invention of rDNA technology is most significant because…

Q: 4) List 3 things that a potential vector must have in order to be useful. 5) Sometimes the gene for…

A: 1.Three things that a potential vector must have in order to be useful is viral replication origin,…

Q: Describe the features of isolated DNA of banana?

A: Introduction All living things, bananas and people included, expire information from one generation…

Q: Identify the three protein complexes/enzymes important in eukaryotic DNA replication A. Enhancer,…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: 1. What is a plasmid? How are they used in bioengineering?

A: Answer : plasmid is the molecule which is known as the extrachromosomal molecule that is present in…

Q: What is the name of the process by which bacteria pick up a different organism’s genetic material?

A: 4. A bacterium takes up a fragment of DNA circulating in its surroundings during transformation. A…

Q: Describe several different DNA repair mechanisms. Which ones contribute to mutations?

A: "Since you have asked multiple questions, we will solve the first question for you. if you want any…

Q: WHY DO WE NEED GENETIC ENGINEERING?

A: Genetic engineering is a vast field that mainly involves using rDNA technology to genetically alter…

Q: 13. In bacteria, mismatch repair involves: A. DNA glycosylase/lyase B. AP endonuclease C.…

A: Introduction DNA is the hereditary material in humans and almost all other organisms, It transmits…

Q: Who are the scientists that proved DNA is the transferrable genetic material and Discuss how they…

A: Introduction DNA was never thought to be the genetic material as it was so inert and lacking…

Q: Suggest reasons for why DNA mutations are not all phenotypic.

A: According to guidelines we have to answer the first question only. so please kindly post the…

Q: Compare and contrast the activity of DNA and RNA polymerases. What is the function of each, what are…

A: Hi, Thanks For Your Question. Answer : Difference DNA Polymerase RNA Polymerase 1. Definition…

Q: 2. If a selection assay be made to identify cells that have incorporated the recombinant DNA, what…

Q: 3. At which step would a mutation lead directly to the formation of an altered gene? DNA is copied…

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Question

Please answer all the questions. I'll definitely give a like.

4. When discussing mismatch repair and base repair mechanisms:
a. Compare and contrast the two mechanisms. Which processes are similar? Which are different?
b. In order to corect mistakes/damage during both processes, the complementary strand is used as a
template. If mismatches or damaged bases 'nucleotides were repaired without regard for which strand
served as template, how would this impact DNA? Explain your answer.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

1) Which statement below explains the trick in sanger sequencing that produces fluorescently labeled fragments at every length within a fragment? a) When synthesizing a copy of the DNA to be sequenced, a high concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a low concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. b) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled dideoxynucleotides (ddNTPs) are used instead of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. c) When synthesizing a copy of the DNA to be sequenced, a low concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a high concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. d) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled…
1. discuss the effect of temperature on the viscosity of the liquid 2. DNA solution is viscous because of the nature of chemical substance that can intercalate into the DNA helix. An example of such substance is acridine orange. experiments revealed that acridine orange causes an increase in the viscosity of DNA solution.how would you account for this effect?
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
1) The function of ligase is to seal nicks in the backbone of a DNA strand. The function of AP endonuclease is to create a nick in the backbone of a DNA molecule adjacent to an apurinic site, which allows DNA polymerase II access to the DNA to repair the damage and prevent a mutation resulting from the use of a damaged or erroneous strand of DNA as template during DNA replication. Why doesn't ligase simply seal up the nicks the AP endonuclease introduces before DNA pol II can do anything?
The statement DNA replicates by a semiconservative mechanism means that (a) only one DNA strand is copied (b) first one DNA strand is copied and then the other strand is copied (c) the two strands of a double helix have identical base sequences (d) some portions of a single DNA strand are old and other portions are newly synthesized (e) each double helix consists of one old and one newly synthesized strand
The two complementary strands of the DNA double helix are held to each other by (a) ionic bonds between deoxyribose molecules (b) ionic bonds between phosphate groups (c) covalent bonds between nucleotide bases (d) covalent bonds between deoxyribose molecules (e) hydrogen bonds between nucleotide bases
Which of the following is/are not required for DNA replication to occur? a. DNA polymerase b. nucleotides c. template DNA d. primers e. helicase f. all are required
Which of the following statements about DNA is false? a. Phosphate is linked to the 5 and 3 carbons of adjacentdeoxyribose molecules. b. DNA is bidirectional in its synthesis. c. Each side of the helix is antiparallel to the other. d. The binding of adenine to thymine is through three hydrogenbonds. e. Avery identified DNA as the transforming factor in crossesbetween smooth and rough bacteria.
Discuss Concepts A forensic scientist obtained a small DNA sample from a crime scene. In order to examine the sample, he increased its quantity by cycling the sample through the polymerase chain reaction. He estimated that there were 50,000 copies of the DNA in his original sample. Derive a simple formula and calculate the number of copies he will have after15 cycles of the PCR.
Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand is from 39 to 59. b. Synthesis of the new DNA strand is from 59 to 39. c. DNA unwinds, primase adds RNA primer, and DNApolymerases synthesize the new strand and remove the RNAprimer. d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite directionfrom the direction in which the replication fork moves.
Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning vectors? a. The plasmid must have resistance to accept DNA inserts. b. They allow the detection of plasmids that contain an inserted DNA fragment. c. They ensure the presence of the ori site. d. They ensure that the plasmid can be cut by a restriction enzyme. e. They allow identification of bacteria that have taken up a plasmid.
What information and materials are needed to amplify region of DNA using PCR?