Please answer asap and type your answer and do not copy from anywhere You are working in a molecular biology lab and have recently received a research grant todevelop a PCR-based DNA test for a specific chromosome mutation found in cancer cells. Inthese cells, a translocation in the middle of two genes causes the production of an abnormalfusion protein that promotes uncontrolled cell proliferation and thus the development ofcancer. Your objective is to amplify the following DNA sequence surrounding the fusion siteusing PCR:5'-AAGCGGGTGTGAGGAGCGCGGCAGCTCAGGTACCCCCGGCCAGGCGCG-3'31-TTCGCCCACACTCCT CGCGCCGTCGAGTCCATGGGGGCCGGTCCGCGC-5'What primer sequences do you need to amplify this piece of DNA?Select one:O 5'-ACACCCGCTT-3 and 5'-GCCAGGCGCG-3¹O 5'-TTCGCCCACA-3' and 5'-GCGCGGACCG-3'5'-TGTGGGCGAA-3' and 5'-CGGTCCGCGC-3'5'-AAGCGGGTGT-3' and 5'-CGCGCCTGGC-3'O 5'-ATGGGGGCCG-3' and 5'-AGCTCAGGTA-3'

Answered: Image /qna-images/answer/ef76075a-0dbe-4ba4-9c41-293650011116.jpg

5'-AAGCGGGTGTGAGGAGCGCGGCAGCTCAGGTACCCCCGGCCAGGCGCG-3' 31-TTCGCCCACACTCCTCGCGCCGT CGAGTCCATGGGGGCCGGTCCGCGC-5' What primer sequences do you need to amplify this piece of DNA? Select one: 5'-ACACCCGCTT-3' and 5'-GCCAGGCGCG-3' 5'-TTCGCCCACA-3' and 5'-GCGCGGACCG-3' 5'-TGTGGGCGAA-3 and 5'-CGGTCCGCGC-3' 5'-AAGCGGGTGT-3 and 5'-CGCGCCTGGC-3' 5'-ATGGGGGCCG-3 and 5'-AGCTCAGGTA-3'

5'-AAGCGGGTGTGAGGAGCGCGGCAGCTCAGGTACCCCCGGCCAGGCGCG-3' 31-TTCGCCCACACTCCTCGCGCCGT CGAGTCCATGGGGGCCGGTCCGCGC-5' What primer sequences do you need to amplify this piece of DNA? Select one: 5'-ACACCCGCTT-3' and 5'-GCCAGGCGCG-3' 5'-TTCGCCCACA-3' and 5'-GCGCGGACCG-3' 5'-TGTGGGCGAA-3 and 5'-CGGTCCGCGC-3' 5'-AAGCGGGTGT-3 and 5'-CGCGCCTGGC-3' 5'-ATGGGGGCCG-3 and 5'-AGCTCAGGTA-3'

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter17: Biotechnology And Genomics

Section: Chapter Questions

Problem 1VCQ: Figure 17.7 You are working in a molecular biology lab and, unbeknownst to you, your lab partner...

See similar textbooks

Similar questions

Figure 17.7 You are working in a molecular biology lab and, unbeknownst to you, your lab partner left the foreign genomic DNA that you are planning to clone on the lab bench overnight instead of storing it in the freezer. As a result, it was degraded by nucleases, but still used in the experiment. The plasmid, on the other hand, is fine. What results would you expect from your molecular cloning experiment? There will be no colonies on the bacterial plate. There will be blue colonies only. There will be blue and white colonies. The will be white colonies only.
You are fresh recruits to a molecular biology laboratory, and your new boss has tasked you tostudy mutations in NRAS, a gene that she suspects is involved in cancer pathogenesis. Task A: Polymerase Chain Reaction Master Mix Your first task is to isolate and amplify the NRAS gene from cDNA extracted from differentsamples through PCR. You will need to run a total of 7 PCRs: 3 normal samples, 3 canceroussamples, and 1 negative control. To make things easier in the lab, when running multiplereactions, the components are prepared not individually, but as a master mix—all thecomponents for multiple reactions are prepared in bulk, except for the template DNA, which isadded separately once the master mix has been distributed into individual tubes. The table below lists the different components for PCR, the available stock concentrations of thesecomponents, and the needed working concentrations for the PCR itself. Complete the table bysupplying the needed volumes of each component for a single…
The temperature at which the primers and target DNA hybridize may be changed to influence the stringency of PCR amplification. What effect will changing the hybridization temperature have on the amplification? Let's say you have a certain yeast gene A and want to check whether it has a human equivalent. How might managing the hybridization's rigor benefit you?
A person with a rare genetic disease has a sample of her chromosomessubjected to in situ hybridization using a probe that is known to recognize band p11 on chromosome 7. Even though her chromosomes look cytologically normal, the probe does not bind to this person’s chromosomes. How would you explain these results? How would you use this information to positionally clone the gene that is related to this disease?
the forward primer used in this experiment incorporates part of the cell recognition site, GGCC. How is this different from the sequence of the human TAS2R38 gene? What characteristic of this PCR reaction allows the primer sequence to override the natural gene sequence? Draw a diagram to support your contention.
One type of cancer is caused by a mutation that occurs in a gene whose length is 2kb. A 200bp deletion is responsible for this mutation, and it is dominant, meaning you only need to have one copy of it to have cancer. A Southern Blot could diagnose this disease, but describe how you could diagnose this disease using PCR instead.
The sequence 5' GCCTAATGCGTTCATAATGGCGTTTGCCACGGACGTAAAGTCGT 3' represents 50% of a PCR product which is cloned into a 1.5 kb plasmid for bacterial expression. What would the agarose gel look like, including a lane for markers, and where would the following pieces of DNA run: 1. the PCR insert 2. the empty uncut plasmid 3. the empty plasmid cut with a single restriction enzyme 4. the cloned plasmid containing the insert
The drawing below depicts a restriction map of a segment of a human chromosome. The cut sites shown (1 through 6) are known to be polymorphic and can be present or absent sending upon the genetic makeup of a specific individual's chromosomes. E identifies Eco RI sites and P identifies Pst 1 sites. The line below the map identifies the region of homology between the DNA and a probe used in Southern blot analyses to characterize this region. A. Individual 1 has restriction sites 1-6 (all) on both copies of this chromosome. If DNA from this individual was digested with Pst I, what are the sizes of the fragments that would be detected via Southern blow using the identified probe? B. DNA from individual 1 is digested with both Eco RI and Pst I and then analyzed by Southern blot. What bands are revealed? C. Individual 2 is homozygous for a polymorphism that eliminates site 3. If DNA from this individual was ingested with both Pst I and Eco RI, what are the sizes of the fragments that would…
Analyze the PCR products in Fig. 1A by describing your observations and the PCR result. Your analysis should be in maximum of 5 sentences in bullet form. Include the following in your analysis: Observations: Are bands present? If yes, what the approximate size in bp of each band? Results: Was amplifying the target gene successful?
You are an expert molecular biologist and you just had your regular PCR run and you are now checking your PCR products if you have amplified the correct desired DNA fragment. Upon checking the results of the electrophoresis, you noticed that you have several bands in your gel. You expected that you will only have a band with the same size as with the "X" size of the DNA ladder. Unfortunately, you have also seen bands that fall in the "W", "Y" and "Z" markers of the ladder. Assume you got a very high quality DNA template from your extraction step. A. What do you think are the possible causes of this incident? Explain briefly.
You want to make a recombinant DNA in which aPCR product amplified from the human genome is inserted into a plasmid vector. The polylinker of thisvector includes recognition sites for the enzymesEcoRI (5′ G^AATTC 3′) and BamHI (5′ G^GATCC3′). (The ^ symbolizes the cut site in the DNA.) PCRprimers that could amplify the fragment of humanDNA are: 5′ GCTACTTCGCGTATTCCA 3′ and5′ CCCAAGTCCTAGCCGATA 3′.a. Describe in detail how these primers would need tobe modified to create a fragment of the human genome flanked by EcoRI sticky ends so that thisfragment could be cloned easily into the plasmidvector. You will need to consider the fact that mostrestriction enzymes, including EcoRI, cannot cutDNA if the restriction site is directly at the end ofthe DNA molecule; the restriction enzyme recognition site must be at least six base pairs distant fromthe end.b. Describe a potential feature of the PCR-amplifiedregion of the human genome that could prevent youfrom using the strategy you described in…
You may have heard of Dolly, the cloned sheep grown from an embryo created in a laboratory. But in the context of DNA mapping, what are clones and what essential role do they play?