Homework Help is Here – Start Your Trial Now!
Science
Biochemistry
5. Regulation of bacterial operons by inducers, e.g. lactose, exhibits which of the following properties? Inducer binds to the Inducer effect on RNA polymerase binding to the promoter Enhances Enhances Repressor produced by: repressor and: A. Activates the repressor B. Activates the repressor C. Activates the repressor D. Inhibits the repressor E. Inhibits the repressor A separate gene Genes of the operon A separate gene Genes of the operon A separate gene Inhibits inhibits No effect 6. Gene transcription rates and mRNA levels were determined for an enzyme that is induced by a newly developed drug. Compared with untreated levels, drug treatment caused a 10x increase in the gene transcription rate and a 20x increase in both mRNA levels and enzyme activity. These data indicate that a primary effect of the drug treatment is to decrease which one of the following? A. The activity of RNA polymerase B. The ability of miRNA to act on mRNA C. The rate of translation D. The rate of binding of ribosomes to mRNA E. The rate of transcription initiation by RNA polymerase 7. Increase of which of the following will result in a left shift of oxygen dissociation curve? A. Concentration of proton B. Concentration of carbon dioxide C. Concentration of 2,3-BPG D. pH E. Temperature 8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach tissues? A. Histidine B. Aspartate C. Asparagine D. Glutamine E. Serine 9. Which region (A to D) of the DNA strands shown can serve as the template for transcription of the region of an mRNA that contains the initial codon for translation of a protein with 300 amino acids? A B

5. Regulation of bacterial operons by inducers, e.g. lactose, exhibits which of the following properties? Inducer binds to the Inducer effect on RNA polymerase binding to the promoter Enhances Enhances Repressor produced by: repressor and: A. Activates the repressor B. Activates the repressor C. Activates the repressor D. Inhibits the repressor E. Inhibits the repressor A separate gene Genes of the operon A separate gene Genes of the operon A separate gene Inhibits inhibits No effect 6. Gene transcription rates and mRNA levels were determined for an enzyme that is induced by a newly developed drug. Compared with untreated levels, drug treatment caused a 10x increase in the gene transcription rate and a 20x increase in both mRNA levels and enzyme activity. These data indicate that a primary effect of the drug treatment is to decrease which one of the following? A. The activity of RNA polymerase B. The ability of miRNA to act on mRNA C. The rate of translation D. The rate of binding of ribosomes to mRNA E. The rate of transcription initiation by RNA polymerase 7. Increase of which of the following will result in a left shift of oxygen dissociation curve? A. Concentration of proton B. Concentration of carbon dioxide C. Concentration of 2,3-BPG D. pH E. Temperature 8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach tissues? A. Histidine B. Aspartate C. Asparagine D. Glutamine E. Serine 9. Which region (A to D) of the DNA strands shown can serve as the template for transcription of the region of an mRNA that contains the initial codon for translation of a protein with 300 amino acids? A B

Biology: The Unity and Diversity of Life (MindTap Course List)
Biology: The Unity and Diversity of Life (MindTap Course List)
15th Edition
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Chapter10: Control Of Gene Expression
Section: Chapter Questions
Problem 15SQ
See similar textbooks
icon
Related questions
Question
5. Regulation of bacterial operons by inducers, e.g. lactose, exhibits which of the following properties? Inducer effect on RNA polymerase binding to the promoter Inducer binds to the Repressor produced by: repressor and: Activates the repressor A. Activates the repressor A separate gene Genes of the operon A separate gene Genes of the operon A separate gene Enhances В. Enhances Activates the repressor D. Inhibits the repressor Inhibits the repressor С. Inhibits inhibits Е. No effect 6. Gene transcription rates and mRNA levels were determined for an enzyme that is induced by a newly developed drug. Compared with untreated levels, drug treatment caused a 10x increase in the gene transcription rate and a 20× increase in both mRNA levels and enzyme activity. These data indicate that a primary effect of the drug treatment is to decrease which one of the following? A. The activity of RNA polymerase B. The ability of miRNA to act on mRNA C. The rate of translation D. The rate of binding of ribosomes to mRNA E. The rate of transcription initiation by RNA polymerase 7. Increase of which of the following will result in a left shift of oxygen dissociation curve? A. Concentration of proton B. Concentration of carbon dioxide C. Concentration of 2,3-BPG D. pH E. Temperature 8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach tissues? A. Histidine B. Aspartate C. Asparagine D. Glutamine E. Serine 9. Which region (A to D) of the DNA strands shown can serve as the template for transcription of the region of an mRNA that contains the initial codon for translation of a protein with 300 amino acids? В 5' AGATGCCCTAAGGTCATTGTT 3' 3' TCTACGGGATTCCAGTAACAA 5' C D А. А В. В С. С D. D E. None of the above
Transcribed Image Text:5. Regulation of bacterial operons by inducers, e.g. lactose, exhibits which of the following properties? Inducer effect on RNA polymerase binding to the promoter Inducer binds to the Repressor produced by: repressor and: Activates the repressor A. Activates the repressor A separate gene Genes of the operon A separate gene Genes of the operon A separate gene Enhances В. Enhances Activates the repressor D. Inhibits the repressor Inhibits the repressor С. Inhibits inhibits Е. No effect 6. Gene transcription rates and mRNA levels were determined for an enzyme that is induced by a newly developed drug. Compared with untreated levels, drug treatment caused a 10x increase in the gene transcription rate and a 20× increase in both mRNA levels and enzyme activity. These data indicate that a primary effect of the drug treatment is to decrease which one of the following? A. The activity of RNA polymerase B. The ability of miRNA to act on mRNA C. The rate of translation D. The rate of binding of ribosomes to mRNA E. The rate of transcription initiation by RNA polymerase 7. Increase of which of the following will result in a left shift of oxygen dissociation curve? A. Concentration of proton B. Concentration of carbon dioxide C. Concentration of 2,3-BPG D. pH E. Temperature 8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach tissues? A. Histidine B. Aspartate C. Asparagine D. Glutamine E. Serine 9. Which region (A to D) of the DNA strands shown can serve as the template for transcription of the region of an mRNA that contains the initial codon for translation of a protein with 300 amino acids? В 5' AGATGCCCTAAGGTCATTGTT 3' 3' TCTACGGGATTCCAGTAACAA 5' C D А. А В. В С. С D. D E. None of the above
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 2 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Biology: The Unity and Diversity of Life (MindTap…
Biology: The Unity and Diversity of Life (MindTap…
Biology
ISBN:
9781337408332
Author:
Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:
Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:
9781305389892
Author:
Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:
Cengage Learning
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Biology (MindTap Course List)
Biology (MindTap Course List)
Biology
ISBN:
9781337392938
Author:
Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:
Cengage Learning
Biology: The Unity and Diversity of Life (MindTap…
Biology: The Unity and Diversity of Life (MindTap…
Biology
ISBN:
9781305073951
Author:
Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:
Cengage Learning
SEE MORE TEXTBOOKS