6. H₂C HO Which of the following dinucleotides can be methylated by DNA methyltransferase? NH₂ NH₂ 9 N NH NH N 'N' "NH₂ NH₂ HO HO 'N NH₂ NH₂ ozo HO B HO opozo HO HO НО D N "NH₂
Q: Lipid molecules contain either saturated or unsaturated fatty acids. You may have seen different…
A: Molecular structures containing fatty acids have an alkane ring and an acidic carboxylic group…
Q: Explain the concept behind capillary electrophoresis
A: Introduction: The technique of capillary electrophoresis was first described by Jorgensen and Lukacs…
Q: Which of the following is not a net product (i.e. of both phases) of the pentose phosphate shunt?…
A: Pentose phosphate pathway involves two phases , oxidative and non oxidative . It is a primary…
Q: Using the data provided use a Michaelis-Menten and Lineweaver-Burk plot to determine the K and Vmax…
A: Enzyme kinetics are studied mostly by Michaelis Menten equation shown below: V =VmaxSKM+S It can be…
Q: b) Consider the following experimental results: Total hydrolysis of a nonapeptide gave:…
A: Proteins or peptides are made up of twenty standard amino acids that are attached together via…
Q: II. A 45-ycar-old man complained of rapid weight loss, tachycardia, increased sweating, occasional…
A: A pheochromocytoma is a tumor in the adrenal gland and causes hypersecretion of hormones from this…
Q: What is the principle of dialysis? A. Highly soluble contaminants will be removed as the…
A: The removal of contaminants from a protein sample is important in the purification of proteins.
Q: b) Consider the following experimental results: Total hydrolysis of a nonapeptide gave:…
A: The linear sequence of amino acids within a protein is considered the primary structure of the…
Q: Glucocorticoid use results in in the amount of glucose that is taken up into muscle cells and…
A: One of the class of corticosteroid is glucocorticoids, which ate class of steroid hormones.…
Q: The origin of the word "enzyme" comes from Greek and means: Group of answer choices in bacterium in…
A: An enzyme is a biological catalyst that increases the rate of biochemical reactions.
Q: In sickle cell anemia, an inherited form of anemia in which the hemoglobin distorts the red blood…
A: The mutation that alters the codon that codes for a specific amino acid is called missense mutation.…
Q: The conversion of glyceraldehyde-3-phosphate to 1,3-bisphosphoglycerate is the only oxidative…
A: Glycolysis is a metabolic pathway in which glucose is converted into pyruvic acid and ATP releases.…
Q: 6. Gluconeogenesis generates ________. Select one: A. 2 ATP and 2 NADH B. 1 ATP and 1 NADH C. 1…
A: Gluconeogenesis is a metabolic pathway that results in the generation of glucose from certain…
Q: Draw the Haworth Projection or the cyclic structure of the following:
A: organic compound organized in the form of aldehydes or ketones with multiple hydroxyl groups coming…
Q: Why is the formation of a peptide bond called a condensation reaction? Explain briefly
A:
Q: ______ 1. is a serine protease that cuts the peptide after aromatic amino acids ______ 2. is a type…
A: 1. Chymotrypsin is a serine protease that cuts the peptide after aromatic amino acids. 2. Covalent…
Q: How many ATP and NADH molecules would be produced during the citric acid cycle if 3 molecules of…
A: Metabolic pathways are a series of process which includes chemical reactions occurring in a cell.…
Q: In your own understanding, what do you think is/are the reason why most of the clinical features of…
A: Deficiency disease is described as a type of disease that is majorly caused due to the lack of some…
Q: transmembrane portion of an alpha helix?
A: The alpha helix is a common motif in the secondary structure of proteins and it is a right…
Q: A. Write the structure of the following peptide at pH 5.0 and calculate its net charge at this pH.…
A: Hi. Thank you for the question. As per the honor code, We'll answer the first question since the…
Q: Which statements are associated with positively cooperative oxygen binding of a protein? A. The…
A: Haemoglobin is a tetrameric protein. It is a heterotetramer consisting of two alpha subunits and two…
Q: In a different instance of (d) two intants suspected to have a defi- ciency of the PDH complex…
A: During cellular respiration, respiratory substrates like glucose may undergo complete or…
Q: Question 13 Which of the following can determine location of glysosidic linkages? O Polarimetric…
A: A glycosidic linkage or bond is a type of covalent bond that joins the carbohydrate or sugar…
Q: (a) In what important ways do the α helix and β sheet structures differ? (b) How are they similar?
A: α helix and β sheet structures are the forms of the secondary shape of the protein. They each are…
Q: Explain the importance of carbohydrates in your body
A: Carbohydrates are among the most important biomolecules needed for the sustenance of life. They are…
Q: Table Q1(a) shows typical values for the intracellular and extracellular concentrations of the major…
A: All cells have an electrical potential difference or membrane potential across their plasma…
Q: The structure of the dipeptide Gly-Asn is given by The structures of the amino acids Gly and Asn are…
A: Glycine (Gly - 3 letter code ) and Asparagine (Asn) are amino acids. Amino acids are the building…
Q: Please answer post lab question and give a conclusion about the experiment
A: Browning of potatoes is caused by the polyphenol oxidase enzyme. In the presence of oxygen, the…
Q: Total Number of NADH Obtained from one Pyruvate Molecule Total Number of FADH2 Obtained from one…
A: In respiring bacteria pyruvate is further oxidized after it is transported into mitochondria that is…
Q: Which of the two carbon sources, glucose or acetate, is more advantageous for the cultivation of…
A: E.coli - Escherichia coli, it requires a carbon source to grow to serve as substrate for the…
Q: Some enzymes require additional ...........................to catalyze reactions effectively. These…
A: Introduction: Enzymes are large biological molecules important for thousands of metabolic processes…
Q: Question 1 What is the main purpose of beta oxidation? to produce ATP from fat to produce CO2 from…
A: The four major steps in glucose metabolism are glycolysis, pyruvate oxidation, the Krebs cycle, and…
Q: The hydrolysis of a substrate, S, by an enzyme has been studied in the lab. The following initial…
A: Consider the reaction where a substrate 'S' is converted to its product 'P' by an enzyme. The rate…
Q: Whatarethewater-solublevitamins?Describeeachandtheirsources.
A: Introduction: Vitamins are organic compounds required in the diet in minimal amounts to perform a…
Q: what are the dietary fats, and what are the dietary fat food and calorie densed beverage that lead…
A: Fats are made up of glycerol and fatty acids. Fats are classified into two types, saturated and…
Q: In the Krebs Cycle (Citric Acid Cycle), A 4-carbon compound with a 2-carbon unit to yield a 6-carbon…
A: Kreb cycle/ tricarboxylic acid cycle/ citric acid cylce - occur in matrix of mitochondria.
Q: The reason for the decrease in the rate of enzyme reaction as the temperature is increased beyond…
A: An enzyme is a substance which serves as a catalyst in living things, governing the rate of chemical…
Q: Q1. Many of the components for lipid synthesis need to be "activated", which happens by a variety of…
A: Lipids are non-polar biomolecules, which act as the major components of the plasma membrane, energy…
Q: What is the purpose of the low temperature step in the PCR reaction? a. To allow DNA polymerase to…
A: The denaturation step of PCR is optimized for high temperatures. The annealing step in PCR is…
Q: Amanufacturer of a line of patentmedicines is preparing a production plan on medicines A and B.…
A: Decision variable: A = bottles of medicine A (1000 units) B = bottles of medicine B (1000 units)…
Q: Identify the ligand that bind to uniprotkb-P39086, the type of allostery, and describe the general…
A: P39086 is an ID for a protein GRIK1_HUMAN that belongs to Homosapiens. It is a protein of 918 amino…
Q: Could I have help with number 3: What biological process is similar in mechanism to soap emulsifying…
A: Introduction: The emulsion is a liquid preparation, that contains a mixture of two or more…
Q: A plant isolate was subjected to qualitative tests to determine the presence of macromolecules.…
A: Biological macromolecules are constituted of proteins , nucleic acids (DNA or RNA), carbohydrates…
Q: Properties of Body Fluids.
A: "Since you have posted multiple questions, we will answer the first question for you. If you want…
Q: Identify if the following is a pyrimidine/purine nucleotide or a pyrimidine/purine nucleoside and…
A: Answers Image A - The given image is a Purine Nucleoside. It has deoxy ribose sugar molecule in it.…
Q: Which of the following is true regarding folate/folic acid: a.Intakes below recommended dietary…
A: Folic acid is B family Vitamin which aids in the formation of healthy new cells in the body. Folic…
Q: Genskap/Property A-DNA B-DNA Z-DNA Algehele proporsies/Overall Kort en 1.3.1 Verleng en proportions…
A: The Watson-Crick double-helical model explains the features of the B form of the DNA. There are many…
Q: Describe the endogenous mechanisms that regulate cholesterol synthesis.
A: Regulation is a process, where enzymes are activated or inhibited to carry out certain process or…
Q: Write the saponification reaction of the following triglyceride with NaOH Н-С-О CH3 H-C-O- `CH3…
A: Triglycerides, also known as fat molecules, are composed of long chains of fat. In the presence of…
Q: What are the different solid phases that antibody or antigen can bind to, in ELISA?
A: Quantitative immunological techniques that use a solid phase can be defined as solid-phase…
Step by step
Solved in 2 steps
- 1.what Human diseases that result from variations in multiple genes? 2.what Alternate forms of nitrogenous bases in which a proton has migrated to an alternative position.? 3. what Stereoisomers of furanose and pyranose rings which differ in the orientation of the hydroxyl group at the C1 position? 4.which Highly compacted strongly staining region of the chromosome with no transcriptional activity? 5. what DNA sequences that specify the transition between euchromatin and heterochromatin? 6. Once cells have passed the restriction point in this phase of the cell cycle they are committed to go through the entire cell cycle. 7.which Cdks belong to a family of serine/threonine? 8. what is A protein that tags another protein for proteolysis?1. Certain proteins that stimulate expression of a gene bind to DNA in a sequence specific manner and also induce conformational changes in the DNA. Describe the purpose of thses two modes of interaction with the DNA. 2. Draw the structures of the amino acid side chains that correspond to the following histone modification: a) acetylation of lysine; b) phosphorylation of serine; c) phosphorylation of histidine. How do thses modifications change the character of their respective side chain?1. a specific type of histone methyltransferase catalyze the methylation of a single lysine or a single arginine in a histone protein. Draw the structures of methylated lysince and methylated arginine reside. 2. the reversal of histone arginine methylation converts the methyated arginine to citrulline in a reaction that consumes H2). Draw the resulting amino acid residue. What os the pther product of the reaction?
- New drugs are being developed that decrease DNA methylation and prevent the removal of acetyl groups from histone proteins. Explain how these drugs could affect gene expression to help kill tumor cells.IPSCs are nearly identical to human embryonic stem cells in terms of gene expression, but there may be other ways in which they are not equivalent. For example, the telomeres of IPSCs often vary in length, with many IPSCs cells having telomeres shorter than those of embryonic. How might shortened telomeres affect the life-span of IPSCs or of differentiated cells derived from them?A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
- About 95% of the average human transcription unit consists of: a. short repeat sequences. b. protein-coding sequences. c. regulatory sequences. d. introns. e. origins of replication.An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.8. As explained in the text, the cause of many geneticdiseases cannot yet be discerned by analyzing wholeexome/genome sequences. But in some of theseseemingly intractable cases, important clues can beobtained by looking at mRNAs or proteins, ratherthan at the DNA.a. As you will see in more detail in later chapters, it ispossible to use single-molecule methods to sequence cDNA copies of millions of mRNA molecules from any particular tissue cheaply. Howcould you sometimes use such information to finda disease gene? When would this information benoninformative?b. A technique called Western blotting allows you toexamine any protein for which you have an antibody; it is possible to see differences in size oramount of that protein. How could you sometimesuse such information to find a disease gene? Whenwould this information be noninformative?
- 1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…1. List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
