Genskap/Property A-DNA B-DNA Z-DNA Algehele proporsies/Overall Kort en 1.3.1 Verleng en proportions breed/short and dun/elongated and thin broad 1.3.2 Regshandig/right- Regshardig/right- Linkshandig/Left- handed handed handed Basepare per heliksdraai/base 1.3.3 10 12 pare per turn of helix 1.3.4 anti anti anti (C), syn (G)
Q: Using the data in this table, what is the AG° (in KJ/mol) for the reduction of FAD by water
A: The change in free energy is indicative of whether a reaction is spontaneous or not. If a reaction…
Q: Neurotransmitters of inhibitory signal makes the membrane potential more positive. Select one: O…
A: Hi, thank you for posting the question on Bartleby. As per the guidelines, we are authorized to…
Q: 2. What conclusion may be drawn about the possibility of a solution of pure soap in distilled water…
A: Soap is produced by the saponification reaction or hydrolysis of fat .The soaps are mostly fatty…
Q: Glucocorticoid use results in in the amount of glucose that is taken up into muscle cells and…
A: One of the class of corticosteroid is glucocorticoids, which ate class of steroid hormones.…
Q: Phosphofructokinase (PFK-1) is ____ when ATP levels are low, and ____ when ATP levels are high. a…
A: Phospho Fructo Kinase 1, PFK1 is an important Enzyme of Glycolysis that convert fructose 6 phosphate…
Q: In Zak-Henley's method in Determination of Total Serum Cholesterol, determine role of the sulfuric…
A: Cholesterol is a type of steroid. The normal serum cholesterol is 125-200mg/dL. Elevated serum…
Q: What aeration condition (presence or absence of O2) favors cell growth? What is the metabolic…
A: Aeration means the presence of oxygen and anaerobic condition means the absence of oxygen. The…
Q: hich of the following play an important role in synthesis of DNA/RNA: a.B-12 b.Folic acid c.Sodium…
A: The RNA is synthesized by RNA polymerase enzymes from a DNA template through DNA transcription.…
Q: Match the following descriptions with the correct lipid-based compounds:…
A: Lipids are a class of compounds that are insoluble in water and soluble in nonpolar solvents. Lipids…
Q: this be done in bond line
A: No.
Q: Amanufacturer of a line of patentmedicines is preparing a production plan on medicines A and B.…
A: Decision variable: A = bottles of medicine A (1000 units) B = bottles of medicine B (1000 units)…
Q: Saponification is a process by which triacylglycerols are hydrolyzed to produce glycerol and fatty…
A: Triglycerides have a glycerol backbone with the hydroxyl groups esterified with fatty acids.
Q: Complete table 2. * Since you were not able to conduct an actual experiment on these tests, kindly…
A: Bromine test is a qualitative analysis of organic chemistry to detect unsaturation, anilines and…
Q: Choose all that aplly that are TRUE for the lipid bilayer: Negative mark is given to incorrect…
A: A lipid bilayer is described as a very thin layer that is made up of two different layers of…
Q: the first two reactions in glycolysis associated with unfavorable ∆G° values, i.e., ∆G° > 0, both…
A: Glucose molecules are metabolized through the glycolytic pathway to release energy in the form of…
Q: Match the following methods of Analysis Fractional analysis, methylation, and periodate oxidation A.…
A: Methods of analysis are different techniques used to analyse a compound for determination of its…
Q: Give the functions of both water-soluble and fat-soluble vitamins
A: The B vitamins (folate, thiamine, riboflavin, niacin, pantothenic acid, biotin, vitamin B6, and…
Q: Show a chemical reaction involving hydrogen peroxide and the enzyme present in potato. What enzyme…
A: Chemical reactions and processes are sped up by catalysts or chemicals found in all living things.…
Q: a) what hormone is high scereted in this condition?
A: Insulin
Q: A patient is prescribed 15mmol of potassium chloride injection. The ampoule contains 20mmol in 10ml.…
A: Given data A 10 ml ampule contains = 20 mmol
Q: Match each Sl unit to the quantity it measures. degree Fahrenheit second gram kelvin nanosecond…
A: A unit of measurement is a conventionally defined magnitude of a quantity, that is used as a…
Q: Antagonist binds to the enzyme at a site far away from the receptor site to inhibit the function of…
A: Glycolysis converts glucose to pyruvate which is then oxidized to carbon dioxide and water by the…
Q: b) Consider the following experimental results: Total hydrolysis of a nonapeptide gave:…
A: Proteins or peptides are made up of twenty standard amino acids that are attached together via…
Q: The following bond makes bovine pancreatic trypsin inhibitor as one of the stable proteins.…
A: Introduction: Bovine pancreatic trypsin inhibitor (BPTI) binds to trypsin and prevents peptide…
Q: a. Is the disaccharide below a non-reducing sugar? yes or no b. The glycosidic linkage in the…
A: Carbohydrates are composed of carbon, oxygen, and hydrogen which are connected by the…
Q: What is pH
A: It measures how acidic or alkaline the given solution is. It is very important to maintain the…
Q: What is the purpose of the low temperature step in the PCR reaction? a. To allow DNA polymerase to…
A: The denaturation step of PCR is optimized for high temperatures. The annealing step in PCR is…
Q: Match the following methods of Analysis v Fractional analysis, methylation, and periodate oxidation…
A: The Biochemical analysis techniques are a set of methods, procedures and assays. This enables…
Q: In your own understanding, what do you think is/are the reason why most of the clinical features of…
A: Deficiency disease is described as a type of disease that is majorly caused due to the lack of some…
Q: The fact that some eukaryotic rRNAs are self-splicing indicates that RNA structures are highly…
A: Introns are non-coding sequences, which are removed during the process of splicing. Splicing is…
Q: Which of the following is NOT a major source of protein? A. fish B. Milk C. Egg D. Rice
A: Introduction: Proteins are organic substances and polymers of amino acids. The elements present in…
Q: ОРОЗ CH2 OH ОН ОН ÓH
A: In the given molecule a phosphate group is attached to a monosaccharide at the 6th carbon.…
Q: Based on the given picture, answer numbers 1-3. Also, answer number 4. 1. What are the two…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, please repost…
Q: In addition to cleaving peplides, chymotrypsin can akso catalyze the hydrołysis of certain small…
A: Hi! Thank you for the question. We are authorized to answer one question at a time, since you have…
Q: If we take a cholesterol test and the test results are high or low, what are the reasons that led to…
A: Cholesterol is a waxy substance found in your blood. The body needs cholesterol to build healthy…
Q: 97) In order for a retrovirus to be infectious a. The p25 protein is cleaved by the protease enzyme…
A: Introduction: Retroviruses are a family of viruses that are grouped together based on how it is…
Q: Which of the following molecules is NOT an amphipathic? phosphatidyl choline cholesterol…
A: Amphiphatic are the molecules which contain both hydrophobic as well as hydrophilic in their…
Q: Match the following methods of Anlaysis v Fractional analysis, methylation, and periodate oxidation…
A: Different chemical, physical and enzymatic methods in several applications of biological, chemical…
Q: The most regulated enzyme in glycolysis is a Hexokinase b G3P Dehydrogenase c Pyruvate…
A: Glycolysis is a metabolic pathway during which glucose molecule splits into pyruvate molecules with…
Q: TRUE or FALSE: Fatty acids are synthesized thru a chain of elongation that starts from Acetyl-CoA as…
A: The majority of fatty acids the human body needs are obtained through food. There is a de novo…
Q: 3. Recombinant protein is produced by a genetically engineered strain of Escherichia coli during…
A: Disulfide-bonded proteins primarily mature in the oxidative environment of the eukaryotic…
Q: Explain how do you prepare a 25-mL solution of 1 mg/mL cholesterol stock?
A: Given Values: Volume = 25 ml Concentration = 1 mg/ml
Q: If an amino acid weighs 100 Da, and the protein contains 70 amino acids, what is the weight of the…
A: Amino acids are the building blocks of proteins. Multiple amino acid units are joined together to…
Q: 4. Show exactly which peptide bonds you would expect trypsin to cleave if you set a digest with the…
A: Enzymes are protein molecules that increase the rate of biochemical reactions. Trypsin is an enzyme…
Q: 2. The two diagrams to the right il- lustrate plots of steady-state ki- netic studies to…
A: Phosphofructokinase adds a phosphoryl group from ATP to Fructose 6 phosphate (F6P) to yield Fructose…
Q: What products are formed when the stachyose (refer to the photo) is hydrolyzed? sorbose, 2…
A: Stachyose occurs naturally in numerous vegetables and plants, such as green beans, soybeans, and…
Q: Which of the following lipids is NOT found in biological membranes? glycolipids…
A: Glycolipids are substances expressed on the surface of cellular membrane. Glycolipids are lipids…
Q: What amino acid side chains can be modified by methyl groups? What is unusual about methyl group…
A: What amino acid side chains can be modified by methyl groups? Answer: Methylation is a process of…
Q: Gel Filtration Chromatography Affinity Chromatography SDS-PAGE
A: The branch of biology completely focuses on studying the various biological life processes at…
Q: The picture shown depicts what type of compound binding to an enzyme? A) A competitive inhibitor B)…
A: Regulatory enzymes show increased or decreased catalytic activity in response to specific types of…
Step by step
Solved in 2 steps
- What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. FluxomeFigure 9.10 You isolate a cell strain in which the joining together of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated?T. aquaticusgenomic DNA is 34.3% guanosine nucleotides. What fraction of the DNA is adenosine nucleotides?
- Why does Valerie's blood from her peripheral, tumor and breast samples all show bands of DNA that are 3000 bases and 1282 bases long?EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .This image shows DNA (gray) interacting with a computergenerated model of a TAL protein (multicolored), one of afamily of proteins found only in a species of the bacteriumXanthomonas. The bacterium uses proteins like this one to findspecific gene sequences in cells of the organisms it infects, suchas tomatoes, rice, and citrus fruits. Given what you know aboutDNA structure and considering the image above, discuss howthe TAL protein’s structure suggests that it functions
- Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTTThe text stated that molecular biologists have developed elegant techniques that can convert any type ofDNA end into any other type of DNA end. In thisproblem, consider genomic DNA that is broken bymechanical shearing into random pieces. Some of theends of these pieces are blunt, some have 5′-overhangs, and others have 3′-overhangs.a. Must the two ends of any one genomic DNAfragment be of the same type?b. Explain why the ends with 5′ or 3′ overhangs arenot sticky.c. Researchers can convert ends with overhangs intoblunt ends using either DNA polymerase (plus thefour dNTPs), or nuclease S1, which degradessingle-stranded regions of DNA but not doublestranded regions. Which kinds of ends with overhangs (5′ or 3′) could be converted into blunt endsusing DNA polymerase? With S1 nuclease?When a double-stranded DNA molecule is exposed tohigh temperature, the two strands separate, and themolecule loses its helical form. We say the DNA hasbeen denatured. (Denaturation also occurs whenDNA is exposed to acid or alkaline solutions.)a. Regions of the DNA that contain many A–T basepairs are the first to become denatured as the temperature of a DNA solution is raised. Thinkingabout the chemical structure of the DNA molecule, why do you think the A–T-rich regionsdenature first?b. If the temperature is lowered, the original DNAstrands can reanneal, or renature. In addition to thefull double-stranded molecules, some molecules ofthe type shown here are seen when the moleculesare examined under the electron microscope. Howcan you explain these structures?
- Given this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it tend to cause a deletion to form, or an inversion? Diagram how it (either the deletion or inversion) will happen. xxxxxxxcatatgctttcag (another five hundred or so letters) catatgctttcagxxxxxxxxx Ditto, using this sequence xxxxxxxxcatatgctttcag (another five hundred or so letters) gactttcgtatacxxxxxxxxxxxCOMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGCFor entertainment on a Friday night, a genetics professor proposed that his children diagram a polynucleotide strand of DNA. Having learned about DNA in preschool, his 5-year-old daughter was able to draw a polynucleotide strand, but she made a few mistakes. The daughter’sdiagram (represented here) contained at least 10 mistakes. Q. Make a list of all the mistakes in the structure of this DNA polynucleotide strand.