Q: Explain the difference between Place and Stimulus-Response learning strategies. Include the…
A: The activation of Brain sources that occur in response to auditory, visual and audiovisual stimuli…
Q: Scientists have discovered a new species of bird in Mexico that migrates South to the Amazon…
A: The process of animals migrating over great distances in search of food and shelter, as well as to…
Q: A series of two-point crosses were carried out among five loci (E, F, G, H, and I), producing the…
A: When two genes are near enough on the same chromosome, they are considered to be connected because…
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A: DNA contains the genetic information about the characteristics features of te organism present in…
Q: Give the PLOIDY of the following (ex: haploid, diploid, etc…) 1. oospore 2. prothallus 3. androcyte…
A: Ploidy can be defined as a total number of sets of chromosomed present in a nucleus of a cell.…
Q: The mating below shows the sex chromosome found in two parents and their resulting offspring. FMR1…
A: Introduction An organism's genotype is its entire set of genetic material. The alleles or variants…
Q: Give at least 5 observations from the structures based on fish dissection?
A: Given: For the fish dissection procedure one would require, Medium sized - fish to visualize all the…
Q: How large (as a proportion of body size) should the testes of chimpanzee males be relative to…
A: The testicles are responsible for making testosterone, the essential male sex hormone, and for sperm…
Q: QUESTION 8 The mating below shows the sex chromosome found in two parents and their resulting…
A: The fragile X mental retardation protein is encoded by FMR1, which is found on the X-chromosome…
Q: You are investigating the loss of activity of a particular enzyme in a mutamt bacterium. You…
A: The activity of an enzyme is micromoles of product formed per minute. The enzyme interacts with to…
Q: 1. Plants are classified into three types based on water availability in its habitat. What are these…
A: The plant body is complex, made up of several systems. Each system in the body has a distinct…
Q: Which one of the following sequences is most likely to cause a ribosome to release a mRNA strand?…
A: A ribosome is an inter - cellular structure made up of both RNA and protein that provides as the…
Q: A/An ___ is one of the 13 linear polymers of tubulin subunits that forms a microtubule.
A: The cytoskeleton is made up primarily of microtubules. They are found in all eukaryotic cells and…
Q: 1.Fatigue is caused because of formation and depositing of which among the following acids in…
A: Introduction Fatigue:- It is a term used to describe an overall feeling of tiredness or lack of…
Q: with the Lactose negative go to the Serratia liquefaciens? What does Enterobacter aerogenes causes…
A: Answer
Q: To describe: The ecological niche of humans.
A: The intended function that an organism performs within an environment is its niche.The biotic…
Q: To explain: Whether humans are dominant species or key ştone species.
A: A species is a group of organisms with genetic similarities, the ability to interbreed, and thus the…
Q: i INSERTED make an insertion mutation by inserting a C after the 4th codon. Click show protein. Ø…
A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…
Q: Describe the proximity in time, similarity in timbre, pitch and good continuation? How are these…
A: Sound is defined as the vibrations that travel through the air or another type of medium as an…
Q: 1. ____ are phospholipid with serine at coe that forms rafts that float about within the membrane.…
A: A phospholipid is a lipid with a phosphate group that is found in large amounts in cell membranes.…
Q: Based on the milkfish dissection, describe the structure of skull and vertebral column design. How…
A: Answer :: Milkfish (Chanos chanos) is the only fish species that belongs to Family Chanidae which is…
Q: Stem cells can give rise to many different types of cells. How could stem cells most likely be used…
A: As stem cells are the cells which have the ability to divide and can give rise to many different…
Q: Match the pieces of the negative feedback arc that regulated the increase in stroke volume seen…
A: Answer given in step 2. Thank you.
Q: To examine: Whether the statement "protein tyrosine phosphatases display exquisite specificity for…
A: Protein phosphatases (PPs) regulate a wide range of signalling systems in plants, and their blockage…
Q: Which of the following organisms practice internal fertilization and external development. Chickens,…
A: Introduction :- Internal fertilisation is the joining of an egg and sperm cell inside the female…
Q: Many amino acid biosynthetic operon under attenuation control are also under negative control.…
A: In bacteria, transcriptional attenuation is a common means of regulating gene expression in response…
Q: Sign in Draw Design Layout References Mailings Review View Help Tell me what you want to do nswer:…
A: Polymer are made up of many monomers. The polymerization reaction allows the formation of different…
Q: Explain how an excessive input of phosphate ions into a body of water such as a lake can have a…
A: phosphate is a major nutrient needed for life. Phosphate is the most common form of phosphorus, used…
Q: 8. Which of the following statements about oxytocin is correct? A. Dilation of cervix and baby…
A: Oxytocin is a hormone delivered by the pituitary organ that causes expanded expansion of the uterus…
Q: A group of 3 nucleotides codes for one amino acid. How many codons are needed to make the…
A: Translation: The process through which RNA codes for specific proteins is known as translation. It…
Q: 43) Topic of Lipids A second big category of lipids are isoprenoids. What are three precursors to…
A: Isoprenoids are a broad class of natural products commonly found in plants and other living beings.…
Q: Compare and contrast the difference between a prehistoric organism and modern-day organisms. What…
A: Answer
Q: To examine: Whether the statement "most intracellular signaling pathways provide numerous…
A: Cell signalling, also known as cell-cell communication, is responsible for directing the basic…
Q: Was LUCA likely an RNA-based or DNA-based organism? Why?
A: Answer
Q: This pedigree chart shows the transmission of a trait in a particular family. Based on this pattern…
A: Answer is mitochondrial pattern of transmission. In mitochondrial transmission, disease is…
Q: The erythrocyte sedimentation rate (heaviness) testis oftenusedfor a blood sample as a diagnosis of…
A: Erythrocyte sedimentation rate: The erythrocyte sedimentation rate (ESR or sed rate) is the rate at…
Q: I. CASE ANALYSIS. Read carefully the scenario below and answer the questions that follow. AAG Lys A…
A: Forensic analysis using DNA samples The DNA sequences can be a helpful tool to determine the…
Q: Which of the following Does not describe the juxtaglomerular com Its granular cells produce rennin…
A: In kidney, juxtaglomerular compartment is the key regulator of the functions of each nephrone. It is…
Q: 2. A nursing mother who has an alcoholic drink secretes alcohol into her milk for two to three hours…
A: Alchohol consumption leads to decrease in hormone production.
Q: Why do we use samples in the collection of d
A: Data Collection process is the collection of data in the form of samples for the proposed variables…
Q: how an angiotensin converting enzyme inhibitor ACE such as captopril would effective as an…
A: Anti hypertensive means the drug causes the reduction in blood pressure. Normal blood pressure is…
Q: S-phase arrest in response to glutamine deprivation in KRas-driven cancer cells can be reversed by…
A: The shortage of deoxynucleotides required for DNA synthesis causes KRas-driven cancerous cells to…
Q: Can gelatin hydrolysis be correlated with the pathogenicity of a bacterium? Explain your answer
A: Disclaimer: “Since you have asked multiple questions, we will solve the first question for you. If…
Q: A population has 700 individuals, 85 of genotype AA, 320 of genotype Aa and 295 of genotype aa. What…
A: The Hardy-Weinberg equation is expressed as: p2 + 2pq + q2 = 1 p is the frequency of the "A" allele…
Q: Galactosemia is a recessive human disease that is treatable by restricting lactose and glucose in…
A: Galactosemia is a recessive human disease that is treatable by restricting lactose and glucose in…
Q: The 2C units of acetyl CoA necessary for fatty acid synthesis in the cytosol comes from the 6C…
A: Fatty acid synthesis It is the process of the formation of fatty acids from 2 carbon molecules…
Q: To determine: The trophic levels and the way in which they are related to ecological pyramids.
A: The Sun provides energy to the Earth in the form of light. The organisms efficiently exploit the…
Q: discoideum) occasionally aggregate into a colony. About 20 percent of the amoebae in the colony make…
A: Kin selection favors the reproductive success of the other relatives even at a cost to the…
Q: O Ferquency O haematuria O oliguria
A: The kidneys are bean-shaped excretory organs and it is the main organs of the urinary system as it…
Q: 3 ANE .MOO城が
A: The plasma membrane, also called the cell membrane, is the membrane found in all cells that…
Step by step
Solved in 2 steps with 2 images
- Each DNA strand has a backbone that consists of alternating (a) purines and pyrimidines (b) nucleotide bases (c) hydrogen bonds and phosphodiester linkages (d) deoxyribose and phosphate (e) phosphate and phosphodiester linkagesThe statement DNA replicates by a semiconservative mechanism means that (a) only one DNA strand is copied (b) first one DNA strand is copied and then the other strand is copied (c) the two strands of a double helix have identical base sequences (d) some portions of a single DNA strand are old and other portions are newly synthesized (e) each double helix consists of one old and one newly synthesized strandThe two complementary strands of the DNA double helix are held to each other by (a) ionic bonds between deoxyribose molecules (b) ionic bonds between phosphate groups (c) covalent bonds between nucleotide bases (d) covalent bonds between deoxyribose molecules (e) hydrogen bonds between nucleotide bases
- Describe how the two strands of DNA are oriented with respect to each other.The experiments in which Meselson and Stahl grew bacteria in heavy nitrogen conclusively demonstrated that DNA (a) is a double helix (b) replicates semiconservatively (c) consists of repeating nucleotide subunits (d) has complementary base pairing (e) is always synthesized in the 5 3 direction5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and label the polarity (the 5’ and 3’ ends)
- 1. Consider the following DNA segment: 5’….ATGCCCGATCAGAGCTTT…3” 3’….TAGGGGCTAGTCTCGAAA…5’ A. How many Phosphodiester bonds are required to form this segment of double-stranded DNA? B. How many hydrogen bonds are present in this DNA segment?7. Each nucleotide pair of a DNA double helix weighs about 1 × 10–21 g. The human body contains approximately 0.5 g of DNA. How many nucleotide pairs of DNA are in the human body? If you assume that all the DNA in human cells is in the B-DNA form, how far would the DNA of a cell reach if stretched end to end?(5) What are these short DNA fragments usually called? (6) Which enzyme probably functions here to couple these two newly synthesized fragments of DNA? (7) Is this strand the leading or lagging strand?
- 1) How many bases are found (on one of the strands) in a single twist of a DNA helix: a) 3.4 b) 10 d) 0.34 2)Which of the following is a correct representation of a segment of DNA: a) I b) I and III c) IV and V 3)Consider the following sequence: 5' - AUGGCUACAGAUAGCUGGGGCUGAAAAAAAAAAAAAAA..3'Translated, the corresponding protein contains how many amino acids: a) 6 b) 7 c) 81. discuss the effect of temperature on the viscosity of the liquid 2. DNA solution is viscous because of the nature of chemical substance that can intercalate into the DNA helix. An example of such substance is acridine orange. experiments revealed that acridine orange causes an increase in the viscosity of DNA solution.how would you account for this effect?1. If one DNA single strand has the sequence 5’-AATGCAA-3’, what is the sequence of its complementary strand? 2. When DNA replicates, how is it able to “unwind” its double helix? 3. What are the types and major functions for each type of RNA?
