9. Which of the following mutations would be least detrimental to the function of a protein and why? 1) Silent; 2) Frameshift; 3) Deletion of two nuclcotides; 4) Nonsense; 5) Missense. mem

Q: 5. Consider the following DNA template strand: 3’ GCA- AAA-CAA-ATA-GTG 5’ Using the following…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via a…

Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: The template strand is a DNA strand that functions as a template for the synthesis of complementary…

Q: 7. Complete the table below by specifying where each of the indicated entities is found? Specify the…

A: Post-transcriptional modification is a process that follows after the transcription, where the newly…

Q: 6. Please describe the events that may result in a mature protein not having methionine as the…

A: DNA is the carrier for genetic information in almost all organisms except certain RNA viruses. DNA…

Q: 4. Indicate whether each of the following words orphrases applies to proteins, DNA, or both.a. a…

A: Deoxyribonucleic acid (DNA) is the genetic material of most organisms that contains coded genetic…

Q: 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a…

A: Let's consider an example: DNA strand - 5′-TAC AAA ATA CAG CGG-3′ mRNA strand – 5’ AUG UUU UAU GUC…

Q: 4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA…

A:

Q: 4. In the following figure, mark the position of the start codon, polyA, and the promotor. DNA ORF

A: The DNA sequence codes for the mRNA. DNA sequence consists of all the necessary requirements for the…

Q: List the amino acid sequence of the protein coded for.…

A: The translation is the process of synthesis of amino acids from the mRNA. During the translation…

Q: 7. Fill in the following table. Acid TRNA MRNAI DNA DNA amino sense anti-sense UGA UGA, Histidine…

A: Transcription: It is the process through which the enzyme RNA Polymerase transfers information from…

Q: 6. Two possible paint mutations are the substitution of lysine for leucine or the substitution of…

A: Every physiological characteristic or metabolism of our body mainly controlled by proteins. These…

Q: 3. A missense mutation results in the presence of a different amino acid than was encoded by the…

A: Sickle cell anaemia is an autosomal recessive disorder.

Q: Please describe the events that may result in a mature protein not having methionine as the…

A: Translation process of formation of a sequence of amino acid using messenger RNA as a template.

Q: What are the advantages and disadvantages of mutation?

A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: 1) A molecular biologist creates a form of RNA polymerase that has the same proofreading ability as…

A: A polymerase is an enzyme that helps to synthesizes long chains of polymers or nucleic acids. It…

Q: How many codons are there in the mutated DNA - (b) and DNA - (c)?

A: DNA is the store house of genetic information. This genetic information expressed by the formation…

Q: 8) Which of these describes the function of RNA polymerase? A. Amplifies the “message" by making…

A: Need to find which of the following is correct regarding RNA polymerase function.

Q: 7. Give all the possible Anti-codons for the amino acids listed below. Histidine (His) Isoleucine…

A: Codons is a sequence of three nucleotides that corresponds with a specific amino acid or stop signal…

Q: 4. The sequence of base triplets on the coding strand DNA molecule is TGACCGTTAGCG. Which of the…

A: The genetic code is sometimes referred to as a "blueprint" since it provides the instructions that a…

Q: Which of the following mutations of the DNA sequence TTT TÁC ÁCT would potentially have the least…

A: The genetic information from the DNA is first transcribed into mRNA. The mRNA contains codons, which…

Q: 3. Label the illustration below using the following terms: DNA, MRNA, codon, transcrip translation,…

A: All the living organisms contain genetic material. The genetic material is responsible for passing…

Q: 5. There is more than one codon and tRNA for most amino acids. The L-shaped molecule binds a…

A: Charged tRNA match an mRNA codon with the amino acid it codes. tRNA brings amino acids to…

Q: 8. A single nucleotide polymorphism changes one nucleotide in a gene sequence. The gene 300 bp size…

A: INTRODUCTION Single nucleotide polymorphism Here in a DNA sequence there is an alteration in the…

Q: 7. The following amino acid sequence represents part of a protein. The normal sequence and a mutant…

A: A mutation is a change in the nucleotide sequence of an organism's genome, virus, or…

Q: 2. Describe the process that is occurring in this image protein nibosome

A: The proteins are the final product of a gene that perform all the functions within the cell.…

Q: What does it mean when we say the genetic code is redundant?     a)  A single codon can specify…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Q: Select ALL of the following that apply to translation. Select one or more: a. occurs in the nucleus…

A: The translation is a process that is part of the central dogma that follows the process of…

Q: What codons ar e found in the mRNA for the two mutated DNA?

A: Answer 1: - There are 14 codons in the original DNA sequence. Answer 2:- Similarly, there are 14…

Q: 5. The genetic evidence for a triple code (three nucleotides are responsible- for one amino acid)…

A: The proteins are produced from the mRNA by the translation process. This function is performed by…

Q: 2. The rising of nanotechnology paved way to discover new trends, one of which is the discovery of…

A: The proteins are formed when ribosomes read an mRNA. The base triplets or codons on the mRNA are…

Q: If a different point mutation changed the DNA code from ACG to ACT, would that cause a problem with…

A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…

Q: 9) Which statement is inaccurate (wrong) about mRNA? A) it is double stranded and has thymine B) it…

A: The explanation for the wrong statement is given below.

Q: 1. What is the production of RNA called and what is the enzyme that catalyzes the process?

A: Apologies. We only answer one question at a time. We will answer the first one as the exact one…

Q: 9. What is the purpose of the following? a) spliceosomes b) RNA polymerase c) Protein release…

A: The central dogma of molecular biology involves the processes of transcription and translation that…

Q: How many codons are there in the mRNA?

A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…

Q: Compare the structure and functions of DNA nad RNA.

A: Nucleic acids  DNA RNA DNA : Deoxyribonucleic acid :  It is long chain polymer  of  two…

Q: 3. What are the last three of six nucleotides (bases) of the palindromic site for the enzyme Ndel if…

A: Restriction endonucleases (or restriction enzymes) are enzymes that identify specific sequences in…

Q: C A T A C G C G T A с G

A: The given figure shows the process of DNA replication. DNA replication refers to the process of…

Q: 8. The CAS9 enzyme (shown in red in the image below arget and cut out specific DNA sequences.

A: As you have not mentioned which part to answer, we are answering first three for you. If you want…

Q: 1. Determine the effect of the following mutations on the DNA sequence. In each case, the mutation…

A: Any detectable, inheritable, qualitative or quantitative change in genetic material of an organism…

Q: 5. For each statement, choose the letter that applies the best: P for prokaryote, E for eukaryote, B…

A: Prokaryotes are characterized by the absence of nucleus and membrane bound organelles of eukaryotes…

Q: 5. Which of the following is NOT true about polypeptides? The peptide bond that links the amino…

A: Polypeptide is an unbranched chain of amino acids. Amino acids are linked together by peptide bonds.…

Q: 7. Discuss the modes of actions by which the following three compounds disrupt DNA- associated…

A: Whether its a cancer cell trying to multiply inorder to generate more cancer cell or a pathogen…

Q: Regarding the triple DNA code, which of the following statements is true?

A: The genetic code refers to the set of rules that all living organisms use to encode information,…

Q: )Which of the following statements are true? Choose all that apply a)There are multiple codons…

A: The DNA expression involves the protein synthesis which involves a series of events primarily the…

Q: 2. What is the minimum number of single nucleotide substitutions that would be necessary for each of…

A: For amino acid production the DNA is transcribed to RNA and RNA is translated to amino acid…

Q: Which of the following carries amino acids?

A: Ribonucleic acid (RNA) is a single stranded nucleic acid found in all living cells. Its different…