Q: 3. An alteration of genetic information is shown below. A-G-T-A-C-C-G-A-T → A-G-T-G-A-T What type of…
A: Alteration of genetic information shown below is an example of Deletion Mutation. In the given…
Q: 5. There are huge amount of DNA in human that are not genetic sequence. Categorize them. The…
A: Minisatellites: They are repetitive sequences of DNA. Repeat length is 10-60 base pairs. Repeated…
Q: ing the gel picture of the DNA ladder, show where your digestion of the paper cutting model showing…
A: DNA is a double stranded biomolecule. The DNA is usually digested by endonucleases and exonucleases…
Q: 1) What DNA base sequence is complementary to the following DNA sequence? TAGCGTGCATGGTGCTTAAC 2)…
A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…
Q: 1. What is the concept of universality of the genetic code? What are the exceptions to this…
A: Introduction The sequence of nucleotides on m-RNA that code for an amino acid is known as genetic…
Q: 4. In the following figure, mark the position of the start codon, polyA, and the promotor. DNA ORF
A: The DNA sequence codes for the mRNA. DNA sequence consists of all the necessary requirements for the…
Q: 1. The definition of a gene is: a. the sum of genetic information in an organism b. a segment of…
A: Defination of the gene :-
Q: 4. Assume that a new low-calorie sweetener is developed. The structure is novel and is tested with…
A: Any product that is intended for human consumption requires prior approval and usage recommendation…
Q: 4. Is there any situation in which DNA is made based on a RNA template? If there is, explain with an…
A: Note: We will answer the first question since the exact one was not specified. Please submit a new…
Q: 1. What is the complementary strand of sequenced DNA? 2. What is the transcription product of this…
A: Here, template stand is given having direction 3'→5' new complementary strand synthesized in 5'→3'…
Q: The functions ascribed to the genetic material are replication, expression, storage, and mutation.…
A: Genetics is a branch of the biology involved in the study of genes, genetic variation, and heredity…
Q: 6. Write a brief paragraph each to explain what an insertion sequence and a transposon are. 7. What…
A: 1. Inclusion arrangements (Insertion sequences) (ISs) are little bits of DNA which move inside or…
Q: 7. Explain the principle of quality determination of DNA.
A: *NOTE: Kindly repost for other questions. Dear Student as per the guidelines we are supposed to…
Q: Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’-T A C T G…
A:
Q: How many codons are there in the mutated DNA - (b) and DNA - (c)?
A: DNA is the store house of genetic information. This genetic information expressed by the formation…
Q: 9.)Which of the following does NOT describe the molecular structure of (DNA) Deoxyribonucleic Acid?…
A: 9- DNA is a double helix ,deoxyribose sugar made up of nitrogenous bases while RNA is ribose sugar.…
Q: n the triplet code, which of the following is true? A. Each DNA base codes for three proteins.…
A: During translation, triplet codon is a set of three nucleotides, which together help to recruit the…
Q: 6. Assume that you are working at a biotechnology company and you are assigned to a project in which…
A: Protein purification is a set of procedures for isolating a single or a few proteins from a…
Q: 1. What is called the functional unit of a DNA molecule that may code for RNA or protein? A. arnino…
A: DNA or deoxyribonucleic acid is the molecule that is made up of polynucleotide chains coiled around…
Q: 3. Consider the following diagrams representing three different DNA molecules. (a) 5' w 3' 3' 5' (b)…
A: DNA polymerase is an enzyme that catalyzes the synthesis of DNA from nucleotide…
Q: What does it mean when we say the genetic code is redundant? a) A single codon can specify…
A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…
Q: 1. Using the central dogma of molecular biology, explain the terms replication, transcription and…
A: Since you have asked multiple questions, we will answer only the first question for you. If you want…
Q: 3. Which of the following represents a similarity between RNA and DNA? A. The presence of Uracil…
A: DNA and RNA are both very essential biopolymers that sustain life. It is present in all forms of…
Q: 1. The two sequences shown below are complementary to each other. T or F GTCGAC CAGCUG
A: Biological macromolecules are those that are made up of large molecules in order to carry out normal…
Q: 2. Suppose the following base sequence was found in a 20-base DNA polymer.…
A: DNA It is a nucleic acid that constitutes two polynucleotide chains that are complementary in…
Q: A tRNA to which the correct amino acid has been attached is called
A: tRNAs bind to codons within the ribosome and deliver amino acids for the protein chain to be…
Q: Define the primary structure of DNA/RNA. Compare and contrast to the primary structure of proteins.
A: DNA/RNA are basically called as nucleic acid and it is important class of macromolecules which is…
Q: 1. What is the first codon in the mRNA strand? 2. The second codon in the DNA double helix is TAT…
A: The DNA (deoxyribonucleic acid) that forms the genetic material of an individual contains…
Q: 5. The genetic evidence for a triple code (three nucleotides are responsible- for one amino acid)…
A: The proteins are produced from the mRNA by the translation process. This function is performed by…
Q: If a different point mutation changed the DNA code from ACG to ACT, would that cause a problem with…
A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…
Q: List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
A: DNA consist of a double-helical structure where one strand is called a sense strand or non-coding…
Q: 1. Why is specific.base pairing essential to the process of transcription and translation? How many…
A: INTRODUCTION There are total 64 codons that code for a total of 20 amino acids. Out of the 64…
Q: 1. The following gel was produced in manual DNA sequencing. What would the unknown DNA template be…
A: The method of determining the nucleic acid sequence – the order of nucleotides in DNA – is known as…
Q: 1) What is the size of the following single-stranded piece of DNA? ATCGTGTGCT A) 10 b B) 20 bp C) 20…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: 7. What are the 4 nitrogen bases? 1. 2. 3. 4. 8. What is their purpose? Why does their order matter?…
A: DNA is a polymer of nucleotide. One nucleotide is made up of one nitrogenous base, one phosphate and…
Q: 1. Determine the effect of the following mutations on the DNA sequence. In each case, the mutation…
A: Any detectable, inheritable, qualitative or quantitative change in genetic material of an organism…
Q: 4. Discuss and detail reasons why eukaryotic organisms appear to have more DNA than is necessary to…
A: The coding sequences of Eukaryotic DNA is called exon and the non coding sequence of Eukaryotic DNA…
Q: 3. The data in the following table represent the base composition of two double stranded DNA sources…
A: Ervin Chargaff discovered the Base proportion in double stranded DNA. The findings in his study came…
Q: 1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand:…
A: Transcription is the process of synthesis of mRNA by using a template DNA strand. Translation is the…
Q: Which of the following initially comes directly in contact with the mRNA during translation? a. 60s…
A: "Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: 1. What structures are these DNA strand likely to adopt in solution (assuming sufficient salt…
A: A-DNA is one of the possible double helical structures which DNA can adopt. A-DNA is thought to be…
Q: (1) Describe the nitrogenous base pairing in DNA and RNA. (2) Determine the number of bonds in each…
A: DNA and RNA are polynucleotides. Monomers of nucleic acids are nucleotides. Nucleotides are made up…
Q: . Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…
A: The central dogma of life involves three processes. They are: Replication: - In this process,…
Q: 1.What are nucleic acids? What are their functions? 2.Illustrate and compare the primary and…
A: Nucleic acids are one of the biomolecules that are important for the carrying of genetic information…
Q: What is meant by ‘annotating’ the genome? How is this done? Which process occurs first? How does…
A: Asked : Genome annotation process and difference from assembly
Q: 1. A portion of the template strand of a DNA molecule that codes for the 5'-end of an mRNA has the…
A:
Q: 1. The following is the DNA sequence of a gene: 3' TACTAACTTAGCCTCGCATC 5' a. What amino acids are…
A: Non sense codons are stop codons which lead to termination of translation. These are - UAA, UAG,…
1. Regarding the triple DNA code, which of the following statements is true?
• each DNA base encodes three amino acids
• there are three genes encoding a protein • each amino acid is encoded by three DNA
•bases each triplet encodes several amino acids
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? complementarity nonsense codons universality degeneracy1. Using the gel picture of the DNA ladder, show where your digestion of the paper cutting model showing cut fragments would appear. The linear uncut DNA is 640 base pairs in length. Insert an image below.1. How many codons are there in the Original DNA sequence?
- 1. How are proteins influenced by mutations in a DNA sequence? 1A: what happens if DNA has a one base mutation in its squence? Provide an example as well1. What does it mean when we say the genetic code is redundant? a) A single codon can specify the incorporation of more than one amino acid. b) The genetic code is universal (the same for all organisms). c) The genetic code is different for different organisms. d) More than one codon can specify the incorporation of the same amino acid.n the triplet code, which of the following is true? A. Each DNA base codes for three proteins. B. Each amino acid in a protein is coded for by three bases in the DNA C. It takes three genes to code for one protein D. Each gene codes for three proteins. E. Each triplet has many different meanings.
- 4. It is known that RNA is a nucleic acid responsible for the synthesis of proteins. However, there is another nucleic acid alongside RNA: DNA. What role does the latter play in relation to RNA? a) RNA is synthesized in the cell in case too large a mutation damages the DNA. b) DNA has the reproductive genetic code of all cells and passes it on to RNA. c) DNA directs the synthesis of enzymes, while RNA synthesizes proteins. d) DNA synthesizes RNA according to a blueprint that includes the guidelines necessary for the structure of proteins.(1) Describe the nitrogenous base pairing in DNA and RNA.(2) Determine the number of bonds in each nitrogenous base pairs.1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA codon. State the process used to convert to mRNA and tRNA.
- 3. The enzyme responsible for transcribing complementary DNA from mRNA is DNA Polymerase Reverse transcriptase RNA Polymerase Endonuclease 6. Sanger DNA sequencing relies on a method known as chain termination. Which molecule is used to terminate DNA chains to create molecules of all possible lengths covering the fragment to be sequenced? Deoxyribonucleotides Deoxyadenosine Deoxyguanosine Dideoxynucleotides1. Which of the following statements about the flow of genetic information is correct?A. Translation occurs prior to transcription during protein synthesis.B. During translation, the DNA template is converted to amino acids by the ribosomes.C. During transcription, the DNA template is converted to an RNA molecule by the enzyme RNA polymerase.D. Eukaryotic mRNA needs to be transported to the cytoplasm before the protein products are synthesized. 2. What is the main difference in the cell wall composition between eukaryotes and prokaryotes?A. Eukaryotic cell wall is mainly composed on sugar molecules while prokaryotic cell wall has both sugars and amino acids.B. Prokaryotic cell wall is mainly composed on sugar and lipid molecules while eukaryotic cell wall has both sugars and amino acidsC. Prokaryotic cell wall is mainly composed on sugar molecules while eukaryotic cell wall has both sugars and amino acids.D. Eukaryotic cell wall is mainly composed on sugar and lipid molecules while…1. Discuss the difference between intron and Exon