90. The DNA template fragment shown was sequenced by the Sanger method. A sample of the DNA was reacted with DNA polymerase and each of the four dNTPs. One of the ddNTPs was added to each of the nucleotide mixtures as ddGTP ddATP ddTTP ddCTP labelled on the drawing. What is the sequence of the template strand? - a) 5'ATCАTGOСС3 b) 5' СCGTACТАЗ c) 5'TAGTACGG 3' d) 5'GGCATGAT3' e) 5'СССАТGATS'

90. The DNA template fragment shown was sequenced by the Sanger method. A sample of the DNA was reacted with DNA polymerase and each of the four dNTPs. One of the ddNTPs was added to each of the nucleotide mixtures as ddGTP ddATP ddTTP ddCTP labelled on the drawing. What is the sequence of the template strand? - a) 5'ATCАTGOСС3 b) 5' СCGTACТАЗ c) 5'TAGTACGG 3' d) 5'GGCATGAT3' e) 5'СССАТGATS'

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1TYK

See similar textbooks

Similar questions

28.Bacteria X contains the double stranded DNA sequence below. Our task is to design a labelled primer (probe) to detect this sequence. Which sequence below can be used for this task? Identify the single most correct answer below. * indicates a label 5' ATGCTTTTTTTAAACCCCGGGGTTTT 3' 3'TACGAAAAAATTTGGGGCCCCAAAA 5' a) 3' AATTTGGGGC* ( b) 3' ATGCTTTTTT* ( ) c) 5' TTTAAAGGG* 19 ( ) d) 5' ATGCTTTTTT* ) e) a and b () f) a and d 23 g) b and d 29.Ames assay is patented, so 2nd yr microbiology students devised a new assay where wild type GFP (green florescence protein AKA light producing) is used as the target gene, for mutation rate analysis. When compound A is added, even in very low concentrations, all colonies formed end up producing light (produce fluoresce). Therefore, one can conclude that compound A is a strong mutagen. () True False 30.The consensus SD (Shine/Dalgarno sequence) is 5' AGGAGGU. Identify the single most correct answer below. a) The SD sequence 3' AGGAGGU is stronger than…
5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer
1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? op 1: 3'-CAGTTAGTCA-5' op 2: 3'-TGACTAACTG-5' op 3: 5'-TGACTAACTG-3' op 4: 3'-TGACTAACTG-5' b) What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3' op 1: 5'-TAGCGTTGACAGTGATA-3' op 2: 5'-TAGTGACAGTTGCGAT-3' op 3: 5'-ATCACTGTCAACGCTA-3' op 4: 5'-UAGUGACAGUUGCGAU-3'
1. You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions.a. PscI & GsuIb. ScaI, PdmI & BsaXI c.ScaI, SspI & EheI
Assume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The highlighted sequences indicate the region bound by primers, either on this strand or on the other complementary strand. 5' ACGTGCGACACGTATATATGTCGCGTGAGTGTAGCGTATCGCTAGAGACGCATACCTATG 3' If the sequence of the forward primer is 5' GCGACACG 3', which of the following sequences would represent the reverse primer? a. 5’ – CAGAGATCGC – 3’ b. None of these sequences would represent the reverse primer c. 5’ – GTCTCTAGCG – 3’ d. 5’ – GCGATCTCTG – 3’ e. 5’ – CGCTAGAGAC – 3’
In the following drawing, the top strand is the template DNA, andthe bottom strand shows the lagging strand prior to the action ofDNA polymerase I. The lagging strand contains three Okazakifragments. The RNA primers, which are shown in red, have not yetbeen removed. A. Which Okazaki fragment was made first, the one on the left orthe one on the right?B. Which RNA primer will be the first one to be removed by DNApolymerase I, the primer on the left or the primer on the right?For this primer to be removed by DNA polymerase I and for thegap to be filled in, is it necessary for the Okazaki fragment inthe middle to have already been synthesized? Explain.C. Let’s consider how DNA ligase connects the left Okazaki fragmentwith the middle Okazaki fragment. After DNA polymerase Iremoves the middle RNA primer and fills in the gap with DNA,where does DNA ligase function? See the arrows on either sideof the middle RNA primer. Is ligase needed at the left arrow, atthe right arrow, or both?D. When…
What is the melting temp. of the following double-stranded DNA fragment CATCGCGATCTGCAATTACGACGATAA GTAGCGCTAGACGTTAATGCTGCTATT
A DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA fragments? a. AGTCCGAAGTC c. GACTTCGGACT b. TCAGGCTTCAG d. UGAGGCUUGAG
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
110.Which of the following best explains the leading daughter DNA strand? A.The gaps within the leading strand are sealed by DNA ligase. B.The leading strand is synthesized by the enzyme primase. C.It is polymerized continuously by DNA polymerase from 5' - 3' direction. D. It is polymerized discontinuously by DNA polymerase from 5' - 3' direction which leaves gaps known as Okazaki fragments.
Meselson and Stahl grew bacteria in medium containing heavy nitrogen. After many celldivisions, the bacteria were removed, washed and allowed to continue growth in mediumcontaining normal (light) nitrogen.a. In this experiment, what part of the DNA gets labeled with heavy nitrogen?