A change in the open reading frame that results in a different protein sequence is called a mutation. complementation point frameshift revertible
Q: enzyme malate dehydrogenase catalyzes the conversion of malate to oxaloacetate in the final step…
A: In a reaction if a molecule is oxidized then other molecule must be reduced. This is called as…
Q: Which statement is TRUE regarding the DNA ligase mechanism?
A: DNA ligases DNA ligases are the enzymes that are responsible for joining the two strands of DNA by…
Q: An American biochemist Erwin Chargaff discovered that in the cells of all organisms he studied, the…
A: Introduction :- All living things are made up of cells, which are the basic building blocks. There…
Q: For the Photosynthesis procedure, you will be detecting if photosynthesis occurs in Elodea plants…
A: Plants with chloroplasts do photosynthesis and produce food .
Q: Hello! dicuss the adaptations of Grapevine downy mildew to invade and manipulate their hosts.…
A: INTRODUCTION Downy mildew is a dangerous fungal disease that can cause significant crop loss in…
Q: Cells were incubated with chloroquine for 2 hours before stimulation with lipopolysaccharide (LPS,…
A: Tumor necrosis factor (TNF) is a multifunctional cytokine that plays important roles in diverse…
Q: Every DNA sequence that can serve as an origin of replication is found to contain a DNA strand that…
A: The DNA double helix is unwrapped at precise locations termed origins, where replication begins.…
Q: Which statement describes Linus Pauling's contribution to the understanding of DNA structure? a…
A: The following statement describes Linus Pauling's contribution to the understanding of DNA structure…
Q: 1. What is the significance of soaking the container in bleach? 2. What is the significance of…
A: Significance of container soaking in bleach before pouring :-
Q: Cytokines and chemokines are major inflammatory mediators. Using examples explain their principal…
A: Inflammatory Mediators An inflammatory mediator is a type of messenger which basically acts on…
Q: Explain why are hemichordates classified "not true Chordates
A: The phylum Hemichordata includes worm-like marine organisms with a proboscis that grows out of the…
Q: O 500 animals O 610 animals O 450 animals O Not yet at K O 200 animals
A: In biology, growth curves are commonly used to represent things like population size or biomass, as…
Q: Essay: In your own words explain the following concept in not more than 5 sentences a. The lock and…
A: A. The lock and key model showing enzyme-substrate interaction. In which the substrate behave like…
Q: Describe the mechanism of V(D)J recombination. At which level in the B-cell development does V(D)J…
A: Each of the two polypeptide chains in immunoglobulins and T cell receptors contributes to the…
Q: Describe and differentiate the thorax of the ox from that of the thorax of the horse and the pig.…
A: Thorax is described as the region that lies between the neck in a superior manner and the abdomen…
Q: Fungi are (a) eukaryotes and opisthokonts (b) prokaryotes and opisthokonts (c) flagellate and…
A: Introduction :- Fungi are eukaryotic organisms that are non-vascular, non-motile, and heterotrophic.…
Q: Item 19 Surfactant is necessary to prevent collapse of the alveoli in the lung because in its…
A: As per our honor code, we are allowed to answer only one question at a moment. You have posted…
Q: Is each of the following haploid, diploid, or dikaryotic: basidiocarp, basidiospore, primary…
A: Each cell have the nucleus, and in the nucleus, they have chromosomes in different sets in different…
Q: b. As we have learned, the HbA1C glycosylation event occurs non-enzymatically in the body. HBA1C…
A: HbAC1 is a glycosylated hemoglobin molecule that is used as an indicator for elevated blood sugar…
Q: Extravasation has two phases: margination and diapedesis. Describe what happens during these phases…
A: Extravasation- The leakage of blood, lymph, or other fluid from a blood vessel into the tissue…
Q: What are some ways in which the relationship between a plant root and a mycorrhizal fungus is…
A: Mutualism is a type of interaction among two organism of different species, in which each organisms…
Q: How is the photic energy absorbed by chlorophyll transfered to ATP molecules in…
A: Photons of light energise the electrons in the chlorophyll molecule. The electrons are attracted by…
Q: Surgical method of sterilization in a woman involves cutting and tying of: A. Ureter B. Uterus C…
A: Tubal ligation is a surgical operation that involves cutting or sealing the fallopian tubes. Having…
Q: 1. Explain how pareto analysis and control charts each help organizations in problem solving and…
A: 1. Pareto analysis is simple decision-making technique for assessing competing problems and…
Q: Match each DNA component to its corresponding point of attachment. 1. carbon 3' 2. carbon 5' 3.…
A: Deoxyribonucleotide (DNA) is a molecule containing all the genetic information needed to make each…
Q: complexes
A: There are total five complexes are involved in the electron transport Chain through which electrons…
Q: genetic influence
A: Genetic influences operate at two levels: 1.The genetic predisposition to certain diseases, 2. The…
Q: Which technology for studying genes do researchers use to attempt to insert genes into the DNA of…
A: ANSWER;- c)gene therapy Explain;- The main strand is the least difficult to imitate. When the DNA…
Q: Watson and Crick, the pair of researchers who determined the structure of DNA, deduced the pairing…
A: According to Chargaff's rule : Pairing between nitrogen bases are followed by this - Adenind -…
Q: b. As we have learned, the HbA1C glycosylation event occurs non-enzymatically in the body. HBA1C…
A: HbA-HbA is the most common type of hemoglobin which is present in red blood cells It is also known…
Q: How do you feel about GMO foods th
A:
Q: A cell that can differentiate into any cell within the same lineage is known as?
A: Stem cells are undifferentiated cells with the ability to divide and differentiate into many…
Q: the four major mechanisms of antibiotic resistance and explain it
A: Antibiotics disrupt essential structures or processes in bacteria. This in turn either kills the…
Q: Name two of the reasons why anthropod phylum has been succesful and describe why each has…
A: Arthropoda are creatures with specifications like hard exoskeletons and jointed limbs. The phylum…
Q: reproductive
A: Turtle- It is an reptile belongs to order Testudines. these are mainly characterized by a shell…
Q: a researcher isolates mRNA from a healthy and diseased liver biopsies. each mRNA sample is converted…
A: RNA molecules were relegated as a simple intermediate between genes and proteins, as encapsulated in…
Q: C. The patient has a pneumonia infection in both lungs. a. Place the patient on bed rest and…
A: Pneumonia is a typical problem that influences a huge number of individuals every year. Germs such…
Q: show the location of attack and draw the structure of the products of a phosphorylation reaction…
A: Adenosine Triphosphate is the energy molecule that provides energy for all cellular processes. It…
Q: Biologists have discovered that many mycorrhizal fungi are sensitive to a low pH. What human-caused…
A: A mycorrhiza is a symbiotic association seen between a fungus and a root of a plant. The term refers…
Q: 28. The muscle has three muscles that act together to simultaneously flex the hip and extend the…
A: Answer
Q: explain how p53 functions in a cell that sustained DNA damage to prevent progression of that cell…
A: p53 induces numerous different target genes and blocks the different stages of progression of tumor…
Q: Question 34 The diarrhea (loose and watery stool) that is a symptom of diseases like cholera is due…
A: Gallbladder is basically associated with digestive system and helpful in storing the bile juice…
Q: hich of the following shorthand names best characterizes the following disaccharide? CH,OH CHOH O.…
A: This is a disaccharide link together by a glycosidic bond. This disaccharide is formed by a…
Q: What were the two major goals of the Human Genome Project? Select all that apply. a to isolate…
A: Introduction :- The Human Genome Project was an international scientific research project aimed at…
Q: 1) Give the genotype of the offspring (this time simply follow the given sequence above and separate…
A: There are three types of genes in Drosophila . These are :- I ) Cinnabar eyes :- Cinnabar eyes are…
Q: Describe the body plan of a fungus.
A: Fungi holds a special place in the five kingdom of classification which consists of usually…
Q: Match the pair of words with the description of the difference between them. Negative allosteric…
A: Enzyme inhibitors are defined as molecules or compounds that bind to an enzyme and affect their…
Q: A.Hawaiian honeycreepers tend to have long and slender beaks to obtain the nectar of the flower…
A: The natural selection is the process by which the organisms are selected in the nature depending on…
Q: Why did Darwin reffered to "decent with modification" rather than the term "evolution".
A: Charles Darwin is known as the father lf evolution. His work particularly focussed on finches in…
Q: source of energy for secondary active transport? O a) hydrolyzed glucose b) cytoskeletal movement O…
A: Introduction - The transport of a solute in the direction of its increasing electrochemical…
Step by step
Solved in 2 steps
- Which of the sequences below do you think would most likely be found in an intrinsically disordered protein? GSSKSSKKREPS MVLITTEVKAT MVLITTEVIIAA All of these could be found in an intrinsically disordered proteinTranscribe the DNA sequence from HbA mRNA: nucleotides: ACGTUPlease answer fast Determine the amino acid sequences for the six open reading frames for this 9 nucleotide sequence: 5'-AAATTTGGG-3'
- Describe the effects of nonsynonymous, synonymous, andnonsense mutations on a protein and the effects of smallinsertions or deletions in an open reading frameTranscribe and translate the DNA strand Remember to use the start and stop sequences. ACGGTACCGTTAGCCGACATCGGGGACACTGACTCGBelow is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?
- Give only typing answer with explanation and conclusion The Shine-Dalgarno sequence (or Shine-Dalgarno box), is a conserved sequence in the mRNA, generally located 8 base pairs upstream of the start codon AUG. The complementary sequence (CCUCCU), is called the anti- Shine-Dalgarno sequence and is located in another cellular nucleic acid. Which one? The antisense strand of DNA of the translated gene The 23S rRNA The fMet-tRNA The 5S rRNA The 16S rRNASequence: CCACCTGTACCCGGACACACCCTGGTGTCC What human disease has been connected to this gene? Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.What type of DNA structure is recognized by RecG and RuvABC?Do you think these proteins recognize DNA sequences? Be specificabout what type(s) of molecular recognition these proteins canperform.
- State if the DNA is written 5' to 3' or 3' to 5' Transcribe the sequence. Include the 5' and 3' Translate the sequence (codon chart included) +1 TAGTCCAAAGGTTTACGTAAATGGGATGTCGAAATTGACTAGATCAHow many possible open reading frames (frameswithout stop codons) exist that extend through the following sequence?5′... CTTACAGTTTATTGATACGGAGAAGG...3′3′... GAATGTCAAATAACTATGCCTCTTCC...5'Define simple sequence repeats (SSRs)