• a DNA ladder with markers every 200 bp (DNA Ladder) • the resulting restriction fragments of the above DNA fragment if it was completely digested with the restriction endonuclease Xho I (Xho I Digest) • the resuiting restriction fragments of the above DNA fragment completely digested with unidentified restriction endonuclease(s) (lanes A through F) Which lane shows the DNA fragment completely digested with Pst ? Lanes DNA Ladder Xho Digest D. 2000 bp 1800 bp 1600 bp

• a DNA ladder with markers every 200 bp (DNA Ladder) • the resulting restriction fragments of the above DNA fragment if it was completely digested with the restriction endonuclease Xho I (Xho I Digest) • the resuiting restriction fragments of the above DNA fragment completely digested with unidentified restriction endonuclease(s) (lanes A through F) Which lane shows the DNA fragment completely digested with Pst ? Lanes DNA Ladder Xho Digest D. 2000 bp 1800 bp 1600 bp

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1TYK

See similar textbooks

Similar questions

As you learned in this chapter,restriction enzymes are sophisticated“scissors” that geneticistsand molecular biologists routinelyuse to cut DNA for recombinant DNAexperiments. A wide variety of onlinetools assist scientists working with restrictionenzymes and manipulating recombinantDNA for different applications. Herewe explore Webcutter and Primer3, twosites that make recombinant DNA experimentsmuch easier.Exercise I – Creating a RestrictionMap in WebcutterSuppose you had cloned and sequenceda gene and you wanted to design a probeapproximately 600 bp long that could beused to analyze expression of this gene indifferent human tissues by Northern blotanalysis. Internet sites such as Webcuttermake it relatively easy to design experimentsfor manipulating recombinant DNA.In this exercise, you will use Webcutter tocreate a restriction map of human DNAwith the enzymes EcoRI, BamHI, and PstI.1. Access Webcutter at http://www.firstmarket.com/cutter/cut2.html.Go to the Study Area for…
Q.1. Imagine you are working for a research laboratory and you are asked to help withthe following:a. Cut the following segment of DNA using E. Co R I. Write the sequence offragments clearly and separately. ATTTACGAATTCTTCCAAGAATTCCTAAATGCTTAAGAAGGTTCTTAAGG b. Show sticky ends? How restriction endonuclease are different from the restriction-modification system?
U have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. PscI & GsuI ______________________________________________________________ ScaI, PdmI & BsaXI ______________________________________________________________ ScaI, SspI & EheI ______________________________________________________________
BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would be created by cutting the normal gene with BamHI?
Examine the DNA sequence shown below. You have been tasked with designing Primers for PCR amplification of the whole fragment shown. Your colleague said that she would design one primer and came up with this sequence – 5’ TGCTATC 3’. You, being a good scientist, need to confirm that her work is good. Where will this primer bind on the target DNA? 5’ CGATGCAATCGAGCTATGGCATATCATAAGCGATAGACAGATAGCA 3’ GCTACGTTAGCTCGATACCGTATAGTATTCGCTATCTGTCTATCGT a. This primer cannot be used in the PCR process. b. It will bind to the top strand on the left side of the fragment. c. It will bind to the bottom strand on the left side of the fragment. d. It will bind to the bottom strand on the right side of the fragment. e. It will bind to the top strand on the right side of the fragment.
Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC
Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’
During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicase
DNA Profiles as Tools for Identification A PCR-based paternity test is conducted using STRs that consistently produce a unique DNA fragment pattern from a single chromosome. Examining the results of the following Southern blot, which male(s) can be excluded as the father of the child? Which male(s) could be the father of the child?
When joining two or more DNA fragments, a researcher can adjust the sequence at the junction in a variety of subtle ways, as seen in the following exercises.(a) Draw the structure of each end of a linear DNA fragment produced by an EcoRI restriction digest (include those sequences remaining from the EcoRI recognition sequence).(b) Draw the structure resulting from the reaction of this end sequence with DNA polymerase I and the four deoxynucleoside triphosphates.(c) Draw the sequence produced at the junction that arises if two ends with the structure derived in (b) are ligated (d) Draw the structure produced if the structure derived in (a) is treated with a nuclease that degrades only single-stranded DNA.(e) Draw the sequence of the junction produced if an end with structure (b) is ligated to an end with structure (d).(f) Draw the structure of the end of a linear DNA fragment that was produced by a PvuII restriction digest (include those sequences remaining from the PvuII recognition…
Examine the DNA sequence shown below. You have been tasked with designing Primers for PCR amplification of the whole fragment shown. Your colleague said that she would design one primer and came up with this sequence – 5’ TTGCATCG 3’. You, being a good scientist, need to confirm that her work is good. Where will this primer bind on the target DNA, and will this primer work as part of a pair to successfully amplify this fragment of DNA? 5’ CGATGCAATCGAGCTATGGCATATCATAAGCGATAGACAGATAGCA 3’ GCTACGTTAGCTCGATACCGTATAGTATTCGCTATCTGTCTATCGT a. It will bind to the bottom strand on the left side of the fragment, and is suitable to amplify the fragment by PCR. b. It will bind to the top strand on the left side of the fragment, but it is unsuitable to amplify the fragment by PCR. c. It will bind to the top strand on the right side of the fragment, but it is unsuitable to amplify the fragment by PCR. d. It will bind to the bottom strand on the right side of the…
The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If the primer in a dideoxysequencing experiment anneals just to the left of this sequence, drawthe sequencing ladder that will be obtained.