Q.1. Imagine you are working for a research laboratory and you are asked to help with the following: a. Cut the following segment of DNA using E. Co R I. Write the sequence of fragments clearly and separately. ATTTACGAATTCTTCCAAGAATTCC TAAATGCTTAAGAAGGTTCTTAAGG b. Show sticky ends? How restriction endonuclease are different from the restriction-modification system?

Q.1. Imagine you are working for a research laboratory and you are asked to help with the following: a. Cut the following segment of DNA using E. Co R I. Write the sequence of fragments clearly and separately. ATTTACGAATTCTTCCAAGAATTCC TAAATGCTTAAGAAGGTTCTTAAGG b. Show sticky ends? How restriction endonuclease are different from the restriction-modification system?

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter15: Studying And Manipulating Genomes

Section: Chapter Questions

Problem 16SQ: Match the method with the appropriate enzyme. _____ PCR a. Taq polymerase _____ cutting DNA b. DNA...

See similar textbooks

Similar questions

Q.No.4. A) Design a oligonucleotide probe for provided gene sequence using all the guidelines for efficient probe designing. ACAACCCCAAGCCTTCAACCACCCCCTTCCCCCAAATTAGAGATCGATCTCAAGAAGAAGAATGGGTTCCGTCTCTCGCTCTTCTTTGGATCAGAAGCTGGCCATGGCAAAGCGCTGCTCCCACGAGGGAGTTGTCGCGGGAGCAAAGGCGGCCGTGGTTGCAACTGTTGCCTCGGCCATTCCTACTTTGGCTAGCGTTAGGATGATCCCATGGGCGAGGTCCTTCCTTAATCCCGCAGCTCAGGCCCTCATCGTTTCATCAGCGGCGGGGGCGGCGTACTTCATAGTTGCGGACAAGACB) Specify the method for Purification of DNA fragment after digestion.(Genetic engineering).
1. Given the following restriction endonucleases and the sequences of their corresponding restriction sites, which would be LEAST useful for cutting the plasmid and the foreign DNA to be inserted? [The arrows indicate where cuts are made.] (see img) a. EcoRI b. HindIII c. HaeIII d. BamHI 2. EcoRI and HindIII are two different restriction enzymes. If the DNA from two different sources were cut with either EcoRI or HindIII, which of the cut DNA fragments would NOT join together easily so that they could be sealed with ligase? a. E. coli DNA cut with EcoRI and human DNA cut with HindIII b. E. coli DNA cut with HindIII and mouse DNA cut with HindIII c. human DNA cut with EcoRI and chimpanzee DNA cut with EcoRI d. mouse liver DNA cut with HindIII and mouse kidney DNA cut with HindIII
Restriction enzymes that are used in the construction of recombinant DNA are endonucleases which cut the DNA at ‘specific-recognition sequence’. What would be the disadvantage if they do not cut the DNA at specific-recognition sequence? Please explain elaborately the answer properly and kindly relate to the NCERT Bio XII chapter 11.
36. When choosing restriction enzymes for cloning a gene of interest into a plasmid, what is an important requirement? Group of answer choices The gene of interest must code for the restriction enzymes which will cleave the sequence The restriction enzyme cleavage site must overlap with a region in the gene of interest The length of the restriction enzyme cleavage site must be 6 nucleotides The restriction enzyme cleavage site must not be present in the gene of interest or antibiotic resistance marker
I-Assume that a circular plasmid is 3200 base pairs in length and has restriction sites for HindIII restriction enzyme at the following locations: 400, 700, 1400, 2600. Give the expected sizes of the restriction fragments following complete digestion.
U have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. PscI & GsuI ______________________________________________________________ ScaI, PdmI & BsaXI ______________________________________________________________ ScaI, SspI & EheI ______________________________________________________________
Q 1. Download and read the attached review article https://www.ncbi.nlm.nih.gov/pmc/articles/PMC342244/pdf/nar00470-0155.pdf titled: MspI, an isoschizomer of HpalI which cleaves both unmethylated and methylated Hpall sites and answer the following question: Restriction enzymes have many applications from gene cloning to gene activity and mapping. Use the two above mentioned restriction enzymes to study transcriptional silencing (consider Southern blot method for your example)
1A) Which of the following best explains Griffith’s transformation experiments? Two strains of S. pneumoniae were used for the experiment. Griffith injected a mouse with heat-inactivated S strain (pathogenic) and living R strain (non-pathogenic). The mouse died and living S strain was recovered from the dead mouse. From this, it was later concluded that that mutation occurred in the DNA of the R-strain cells thus transforming them into a pathogenic S strain. Two strains of S. pneumoniae were used for the experiment. Griffith injected a mouse with heat-inactivated S strain (pathogenic) and living R strain (non-pathogenic). The mouse died and living S strain was recovered from the dead mouse. From this observation, it was later concluded that external DNA from the inactivated S strain was taken up by the R-strain cells thus transforming them into a pathogenic S strain. Two strains of S. pneumoniae were used for the experiment. Griffith injected a mouse…
Restriction maps illustrate the lengths of DNA fragments between restriction sites. Which of the following information can be gathered from the analysis of restriction maps? Select all that apply. a gene sequence b presence of mutations c nucleotide sequence d disease identification
Gene targeting and genome editing are both techniques for removingor modifying a particular gene, each of which can produce thesame ultimate goal. Describe some of the differences between theexperimental methods used for these two techniques.
Briefly describe what happens during each of the phases of PCR (denaturation, annealing, and extension), including when you need each of the major components of the reaction (template, primers, nucleotides, DNA polymerase).
Consider a partial restriction digestion, in which genomic DNA is exposed to a small, limiting amount ofa restriction enzyme for a very short period of time.a. Would the resultant fragments be longer or shorteror the same size as those produced by a completedigestion?