a and b please (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form astable model Holliday junction.W 5' GATCGCАТTСТAGCCGTAАGGTCCACTGTAА 3'х 5' GTCCCАТАCGTAGCCGтAGGACATGTAсCG 3'Y 5' CGGTAСАTGTCСТАСGGCTАСААТGCGAТС 3'Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3’(b) What is branch migration?

In the above figure the sequences are arranged on the basis of complimentarity. Let's assume red…

(a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTСТAGCCGTAGGTССАСТСТАА 3' x 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5' CGGTACATGTCСТАСGGCTACААTGCGATC 3' z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' (b) What is branch migration?

(a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTСТAGCCGTAGGTССАСТСТАА 3' x 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5' CGGTACATGTCСТАСGGCTACААTGCGATC 3' z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' (b) What is branch migration?

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

To create a DNA:RNA hybrid from a short stretch of DNA with the sequence 5'-GGCTAAGTATGCCTAGTAGC-3', design the corresponding RNA sequence. Indicate the sequence in a 5' to 3' manner. What type of helix (A, B or Z) will this double-stranded nucleic acid form?
Which of the molecules of RNA is the most likely to fold into a specific structure as a result of intramolecular (within itself) base-pairing? Explain. 5′-CCCUAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUAGGG-3′ 5′-UGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG-3′ 5′-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3′ 5′-GGAAAAGGAGAUGGGCAAGGGGAAAAGGAGAUGGGCAAGG-3′
Indicate whether each of the following base-pairing situations (1) involves two DNA strands, (2) involves a DNA strand and an RNA strand, or (3) could involve either two DNA strands or a DNA strand and an RNA strand? a. A G T U C A b. A C T T G A c. A G U T C A d. C G C G C G a. A G T U C A b. A C T T G A c. A G U T C A d. C G C G C G
If a polyribonucleotide contains equal amounts ofrandomly positioned adenine and uracil bases, what proportion of its triplets will encode (a) phenylalanine, (b)isoleucine, (c) leucine, (d) tyrosine?
Draw the structure of the first 3 nucleotides in the nucleic acid sequence attaaaggtt tataccttcc caggtaacaa accaaccaac tttcgatctc ttgtagatct gttctctaaa cgaactttaa aatctgtgtg gctgtcactc ggctgcatgc ttagtgcact
Given the structures of the nitrogenous bases shown in the picture, draw the structure of a part of DNA with the sequence: 5'-GTTCA-3'.
What is the melting temperature and G/C content of the following primers? a.) 5’ GAAATAATTTTGTTTAACTTTAAG 3’ b.) 5’ GTAACTCAGCTTTCAGGTCG 3’
Novel antiviral agents isolated from Caribbean sponges led to the development of vidarabine, the first nucleoside drug used to treat herpes infections. (a) What monosaccharide and base are present in vidarabine? (b) Draw the structure of cytarabine, an anticancer nucleoside composed of cytosine and the same monosaccharide unit.
The following are sequences from three different alpha helices found inhuman proteins: hBak(72-87): GQVGRQLAIIGDDINR hCB1(196-210): VTASFTASVGSLFLT hCB2(248-262): LVLAVLLICWFPVL Classify each of these three helices as either a) mostly hydrophobic, b)mostly hydrophilic, or c) amphipathic. Use the helical wheel to explainyour answers. Given the character of these helices, in which part of the protein wouldyou expect them to reside?
In the image attached, there are 4 nitrogenous bases plus ribose used to generate strands of DNA. They are oriented with hydrogen bonding regions aligned. A. Diagram the chemical structure of cytosine hydrogen-bonded to guanine in normal DNA. Please show the H bond interactions clearly with a dotted line. B. In a second diagram, show the enol form of cytosine following a tautomeric shift. Include in the diagram how this change shifts hydrogen bonding characteristics and a new binding partner for this nucleotide.
Each group will be provided with 20 g double-stranded DNA oligomer in STE buffer (0.1M NaCl/ Tris/ 10 mM EDTA, pH 7.4). The sequence of one strand of the oligomer is: 5’-AATGGTACGTATACTTTAT-3’ - show a table of % denaturation of DNA at different temperatures, using the equation provided in “Calculation” - plot a graph of % denaturation of DNA vs different temperatures with clear label and title, and hence determine the experimental Tm of the DNA sample - calculate the theoretical Tm of the sample using Marmur and Doty equation, compare the experimental Tm with theoretical Tm of the DNA sample
Describe the steric interactions that determine the conformations that pyrimidine nucleosides assume.