Like a helices, B sheets often have one side facing the surface of the protein and one side facing the interior, giving rise to an amphiphilic sheet with one hydrophobic surface and one hydrophilic surface. From the sequences listed below, pick the one that could form a strand in an amphiphilic ß sheet. O TLNISFQMELDV DSETKNAVFLIL VLEFMDIASVLD
Q: A TRNA molecule with the anticodon UGC would be carrying the amino acid: Second base of codon…
A: tRNA brings its amino acid to the mRNA in a specific order. This specific order can be determined by…
Q: Which of the following would be considered a severe mutation? A) Leucine (Leu) > Lysine (Lys) B)…
A: Amino acids are classified based on their properties like whether they are polar or nonpolar,…
Q: GCA UGC CGA UAC
A: 1. The tRNA anticodons for the amino acid sequence shown above is - GCA UGC CGA UAC
Q: includes
A: A new Covid, known as serious intense respiratory disorder Covid 2 (SARS-CoV-2), is the aetiological…
Q: Using the nucleotide sequence of an accession number (NM_019121) what is the translated amino acid…
A: Proteins are made up of amino acids. DNA is the genetic material that codes for the amino acids that…
Q: The difference between prokaryotic and eukaryotic protein initiation is that eukaryotes' initiator…
A: Translation is the process of Synthesis of proteins from amino acids by peptide bond formation. It…
Q: Write the consensus sequence for the following set of nucleotide sequences. AGGAGTT AGCTATT TGCAATA…
A: Genes are the structural and functional units of heredity. They carry coded genetic information in…
Q: threonine, alanine, and isoleucine. The TRNA anticodons for the amino acid sequence shown above is…
A: Protein synthesis or translation process takes place on the ribosomes with the help of messenger RNA…
Q: Three E. coli tRNA molecules with the anticodon sequences CGG, OGG , and UGG are charged with the…
A: During Protein synthesis or translation that occurs in ribosomes, messenger RNA code for an amino…
Q: a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of…
A: Mutation - Mutation is defined as the sudden inheritable changes in the structure of the DNA or in…
Q: Consider the following 2 codons sequences. Codon sequence 1: ACU AGA GAU GUC UGC Codon sequence…
A: β-sheets are formed by adjacent parallel or antiparallel peptide strands that are hydrogen bonded in…
Q: Which of the following is not correct regarding protein domains or modules such as the…
A: Amino acids when combined with a peptide bond, they form proteins. Proteins are macromolecules made…
Q: Order of bases in DNA Order of bases in MRNA (codon) AUC Order of bases in tRNA TAG Amino acid coded…
A: Amino acids are the smallest monomers which are known to form the polypeptide sequence of the…
Q: Choose the correct protein sequence that would result from the following DNA template sequence using…
A: Central dogma is the central cellular process that helps in the conversion of the DNA to m RNA by…
Q: A small section of bacterial enzyme has the amino acid sequence threonine, valine, glycine, and…
A: The process of formation of amino acids from the mRNA sequence is known as translation. mRNA…
Q: The top side of this figure offers more opportunities (for each base pair) that can lead to highly…
A: A single stranded nucleic acid is formed by joining the nucleotide units together through…
Q: Which form of flavin adenine dinucleotide is the "reduced" form, FAD or FADH2? Explain
A: Flavin Adenine Dinucleotide: It is a redox active coenzyme associated with various proteins, which…
Q: Second letter UUU Phenyl- UUC alarine UGU UGC Cysteine UAU UCU UCC UCA UCG UAC yrosine Serine UUA…
A: Mutation of amino acids change the primary structure of the protein which affects the protein…
Q: If a tRNA has an anticodon sequence 5'-CAU-3', What would be an amino acid carried by that tRNA?
A: Codon is defined as the the group of three nucleotides that encode an amino acid.
Q: Which amino acid would be attached to a tRNA that read "GGU"? Val (M) Ala (A) Ser (S) 3'- Arg (R) A…
A: Amino acids are the structural unit of proteins, that is made up of carbon, hydrogen, Oxygen and…
Q: What is the net charge of the peptide at pH 7 that is synthesized from this DNA sequence? 5'…
A: As we know that the DNA sequence exhibits codons, which helps in the formation of mRNA, and then…
Q: An anticodon on a TRNA has the sequence 3' UAC 5. What amino acid would it be charged with?
A: The tRNA is the transfer ribonucleic acid and it helps to decode the information present in the mRNA…
Q: Consider the following polypeptide sequence: Gly Val Tyr Ile Val Asp His Phe Thr Gly Asn Tyr Ala Leu…
A: Trypsin breaks down proteins in the duodenum into smaller peptides. Other proteases would further…
Q: Find self-complementary regions in the following RNA sequence: AUGUGGCAUGCCAGG
A: Biomolecules includes carbohydrates, lipids, nucleic acids and proteins. Nucleic acid plays an…
Q: A polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly…
A: Trypsin and chymotrypsin are essential serine proteases that are secreted by the pancreas. They play…
Q: The change of one conformation of protein to another is called a. allosteric transversion b.…
A: Option b Allosteric transition
Q: A polypeptide is digested with trypsin, and the resulting segments are sequenced:…
A: Introduction: A number of enzymes catalyze the breakdown of peptide bonds at a specific site in an…
Q: For the following DNA bases, give the complementary mRNA code that would be transcribed from these…
A: The process of formation of m RNA with the help of DNA is called transcription. During the formation…
Q: Consider à ollowing sequence: His-Cys-Leu-lle-Met where Met is at the C-terminus end. Based on the…
A: Amino Acids are are structures linked by Peptide Bonds to Form Polypeptide Chains. Proteins are…
Q: If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base…
A: The DNA sequence GCATAG will have the mRNA code CGUAUC. When the sequence changed to GCATGG, then…
Q: A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a…
A: Melting temperature is the point at which 50% of double-helical DNA is changed into a…
Q: Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3' O…
A: Answer :- Met-ala-phe-lys-stop DNA…
Q: For each of the proteins involved in DNA replication in E.coli that is shown, select the best…
A: Given, Primase Adds/subtracts supercoils and can remove the knots or loops in DNA DNA…
Q: Please determine the order of aminoacids from a given genetic code? 5’-UGGUACGGUACUCCAC-3’
A: Transcription is the process in which the information present on the DNA is transferred on to a…
Q: Refer to the codon diagram on. Which of the following is a codon that will terminate translation? *…
A: The process of formation of a polypeptide sequence from an mRNA transcript is known as translation.…
Q: For each of the following sequences, rank them in order (from best to worst) as sequences that could…
A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…
Q: Polyglycine, a simple polypeptide, can form a helix with φ = -80°, ψ = +150°. From the Ramachandran…
A: A protein can arrange itself according to requirements. It can be primary, secondary, tertiary and…
Q: Use the first picture and codon table to answer the following questions.
A: The exons are the coding portions of the gene and introns are the non-coding portions, which need to…
Q: If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the…
A: Here in question, I believe “a” side in Phosphodiester bond refer to the side bond to 3’-C atom of…
Q: The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a)…
A: The central dogma of molecular biology is the process of the formation of functional products by…
Q: Which amino acid would you expect a tRNA to be charged with if the TRNA has the anticodon 3' CUG 5'?…
A: Amino acids are biomolecules synthesized by the process of transcription and translation and form…
Q: Use the codon table to determine one possible DNA sequence that corresponds to the following amino…
A: A sequence of three consecutive nucleotides in a DNA or RNA molecule that codes for a specific amino…
Q: Use the genetic code table. Which amino acid is coded for by only one codon sequence? Second…
A: Ans is.. methionine
Q: With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the…
A: The process by which DNA gets converted into RNA molecule is called as transcription and then mRNA…
Q: Trypsin cleaves a polypeptide backbone at the C-terminal side of Arg or Lys residues, whereas…
A: Polypeptide is formed when amino acids are joined together with peptide bonds. Peptide bond is…
Q: This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top…
A: Transcription is the process of formation of mRNA transcript. It can be divided into three stages:…
Q: THE CODON TABLE FIRST POSITION SECOND POSITION THIRD POSITION TT UU UCU UAU UGU Phenylalanine…
A: Mutations are alterations in the genetic sequence. These alterations can be small or big. The…
Q: If a tRNA has an anticodon sequence 5'-CAU-3', What would be an amino acid carried by that tRNA?…
A: We know that the mRNA carries the codon and the tRNA carries the anticodon. The transfer RNA is the…
Q: Determine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the…
A: The sequence are:
Q: E. coli oriC is rich in A · T base pairs. Why is this advantageous?
A: E.coli is a gram-negative bacteria that is found in the lower part of the intestine if warm blood…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- For the m-RNA nucleotide codons given below, what is the corresponding sequence of amino acids? AUG UGU AUA UAU GUA AUC ACC UUC UAU GUA ACA UUU UGG AAC AGC UGC CAU GUA UAC CAG AAA CUU GCA GAG CUG GCU UUG AUA UGA The α-helices are known to contain primarily the amino acids methionine, alanine, leucine, glutamate, and lysine, while β-pleated sheets are known to primarily contain the amino acids tryptophan, tyrosine, phenylalanine, isoleucine, valine, and threonine. Which one of these two types of secondary protein structure is present with this amino acid sequence?Given the fragment Ala-Lys-Tyr-Gly-Phe and Leu-Val-Ser-His-Cys-Arg, what is the expected result in both fragments with CuSO4 and NaOH? a. dark violet solution b. light violet solution c. blue solution d. colorless solutiondraw the structure of the peptide Asp - Asn-Ser-Lys-Pro at PH 8
- What RNA base sequence is complimentary to the following DNA base sequence 5'-CATGATTAT-3'? Using the table of codons, give the primary structure of the protein coded for by the RNA sequence: 5’-CCA CGA GGG GAG ACU UAA-3’?A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) isconstructed, will its melting temperature be higher or lower?Which of these amino acid sequences will most likely favor the formation of a b-pleated sheet secondary structure?
- E. coli oriC is rich in A · T base pairs. Why is this advantageous?The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?A protein with which of the following sequences may be more prone to undergo farnesylation? (a) Trp-Ala-Ala-Cys (b) Ser-Gly-Gly-Glu (c) Ser-Ala-Ala-Trp (d) Cys-Leu-Leu-Ser
- To create a DNA:RNA hybrid from a short stretch of DNA with the sequence 5'-GGCTAAGTATGCCTAGTAGC-3', design the corresponding RNA sequence. Indicate the sequence in a 5' to 3' manner. What type of helix (A, B or Z) will this double-stranded nucleic acid form?Which of the following would be considered a severe mutation? A) Leucine (Leu) > Lysine (Lys) B) Arginine (Arg) > Lysine (Lys) C) Histidine (His) > Arginine (Arg) D) Aspartic Acid (Asp) > Glutamic acid (Glu) E) Valine (Val) > Isoleucine (Ile)The following are sequences from three different alpha helices found inhuman proteins: hBak(72-87): GQVGRQLAIIGDDINR hCB1(196-210): VTASFTASVGSLFLT hCB2(248-262): LVLAVLLICWFPVL Classify each of these three helices as either a) mostly hydrophobic, b)mostly hydrophilic, or c) amphipathic. Use the helical wheel to explainyour answers. Given the character of these helices, in which part of the protein wouldyou expect them to reside?