Indicate whether each of the following base-pairingsituations (1) involves two DNA strands, (2) involves aDNA strand and an RNA strand, or (3) could involveeither two DNA strands or a DNA strand and anRNA strand?a. A G TU C Ab. A C TT G Ac. A G UT C Ad. C G CG C Ga. A G TU C Ab. A C TT G Ac. A G UT C Ad. C G CG C G A22-97 Indicate whether each of the following base-pairingsituations (1) involves two DNA strands, (2) involves aDNA strand and an RNA strand, or (3) could involveeither two DNA strands or a DNA strand and anRNA strand?а.AGTb.АСТUCATG Aс.AGUd. CGCТСАGC G

Nucleotides are the monomers of nucleic acids, DNA and RNA. Each nucleotide is composed of a…

Indicate whether each of the following base-pairing situations (1) involves two DNA strands, (2) involves a DNA strand and an RNA strand, or (3) could involve either two DNA strands or a DNA strand and an RNA strand? а. AGT b. ACT UCA TG A с. AGU d. CGC ТСА GCG

Indicate whether each of the following base-pairing situations (1) involves two DNA strands, (2) involves a DNA strand and an RNA strand, or (3) could involve either two DNA strands or a DNA strand and an RNA strand? а. AGT b. ACT UCA TG A с. AGU d. CGC ТСА GCG

Anatomy & Physiology

1st Edition

ISBN:9781938168130

Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Publisher:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Chapter3: The Cellular Level Of Organization

Section: Chapter Questions

Problem 17RQ: Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG...

See similar textbooks

Related questions

Q: A) Using this rule, determine the percentages of all the bases in DNA that is 20% thymine. [A] = [C]…

A: According to Chargaff's rule the percentage of Adenine [A] is equal to Thymine [T]. So if the given…

Q: The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 10° D. In your answers,…

A: The molecular mass of Escherichia coli DNA genome is 3.1 × 109 Daltons. The average molecular weight…

Q: The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 10 9 D. In your…

A: Hi! As you have posted multiple questions, I will be answering the first and third question for you.…

Q: The two complementary strands of the DNA double helix are held to each other by (a) ionic bonds…

A: DNA is the main constituent of the chromosome. It contains all information about protein that forms…

Q: A key difference between B DNA and Z DNA is thata. B DNA is right-handed, whereas Z DNA is…

A: DNA is the molecule which carries the genetic information of the cell. It is a long biopolymer of…

Q: You have a sample of genetic material. The nitrogenous base content is 29% guanine. a) If the…

Q: Suppose the following base sequence was found in a 20-base DNA polymer. 3'СAGTTAC…

A: DNA, or deoxyribonucleic acid, is a biomacromolecule that is responsible for the transmission of…

Q: In a melting profile for DNA, the absorbance at 260 nm increases as result of the disruption of the…

A: Asked : Reason of Absorbance increases by disruption of DNA structure.

Q: What feature of a DNA fragment causes it to move through a gel during electrophoresis? a. the…

A: Introduction: Gel electrophoresis is a molecular technology that helps to separate the DNA fragments…

Q: Determine the characteristics of this piece of double-stranded DNA. GTCTTTTACTTGAAT…

A: DNA is the double helical structure that contains the information that help in inheritance. The…

Q: The “rungs” of the DNA double helix are held together by a. ionic bonds.b. hydrogen bonds.c.…

A: Introduction: DNA, also known as deoxyribose nucleic acid is made up of nucleotides which comprises…

Q: Given the following sequence for one strand of a double-stranded oligonucleotide:…

A: Nucleic acids are of two types: RNA and DNA RNA It is referred to as ribonucleic acid. It is…

Q: "Chargaff's rules" about the composition of bases in DNA dictates that A. the sum of purine…

A: Chargaff's rules explain the structure and composition of DNA. Chargaff's rules include the…

Q: Given the choices, a. 25 b. 18 c. 23 d. 21 how many hydrogen bonds are present in a DNA double…

A: DNA is also known as deoxyribonucleic acid. DNA acts as genetic material in most of the organisms…

Q: What type of weak interactions stabilize DNA a) salt bridges between bases on opposite strands b)…

A: DNA are polymers of nucleotides. A nucleotide consists of a nitrogenous base(A, T, G, C) attached to…

Q: The Watson and Crick model of DNA structure shows the following EXCEPT A the turn of the DNA helix…

A: Watson and Crick proposed a specific DNA structure called the 3-dimensional DNA. DNA is comprised of…

Q: If 18% of the nucleotide bases in a DNA molecule are Guanine (G) A. What % of the bases are…

A: According to chargraff rule Number of purine= number of pyrimidines

Q: Which of the following statements is (are) true? (a) The two strands of DNA run parallel from their…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: Evidence or approaches that led to the discovery of the DNAdouble helix includea. the determination…

A: Introduction: DNA is the hereditary material present in the nucleus that is responsible to transfer…

Q: AKS 5a: Which of the following combinations is true of the nucleotide composition of a sample of…

A: According to Chargaff's rule, DNA of organisms should have 1:1 stoichiometric ratio of pyrimidine…

Q: Examine the 5 -3' sequence of bases of the DNA molecules (A D) shown below. I am only showing you…

A: For option A, AAAT the complementary strand is TTTA. In this A pairs with T by two hydrogen bonds…

Q: Indicate whether each of the following statements involving differences between DNA and RNA…

A: Nucleic acids are molecules that help in storing information to be used for cellular growth as well…

Q: Enzymes that break down DNA catalyze the hydrolysis of the covalent bonds that join nucleotides…

A: DNA stands for deoxyribonucleic acid. It consists of deoxyribonucleotides.

Q: DNA double helix is stabilized by ... a) H-bonds between the sugar-phosphate backbones. b)…

A: Answer. Watson and Crick first describe the structure of DNA double helix in 1953 e using x-ray…

Q: a. Write the structural formula of GAC, a portion of DNA. Write the complementary strand adjacent to…

A: Nucleotides are the building blocks of nucleic acids. Each nucleotide is composed of a nucleoside,…

Q: Considering the principle of complementary base pairing, you would expect an equal ratio of which…

A: Chargaff's rules define that any DNA irrespective of species or organism has a 1:1 stoichiometric…

Q: A primitive eukaryote was discovered that displayed a unique nucleic acid as its genetic material.…

A: The structure of DNA (deoxyribonucleic acid) double helix was determined with the help of X-ray…

Q: The Watson and Crick model of DNA structure shows A pair bonding between bases a purine and a purine…

A: * The double helical structure of Dna was proposed by Watson and crick * They proposed that The…

Q: Enzymes that break down DNA catalyze the hydrolysis of thecovalent bonds that join nucleotides…

A: Enzymes are biological molecules (typically proteins) that are vital for life and serve a wide range…

Q: Which of the following best explains Chargaff’s rule (a) 3’to 5’ synthesis of DNA (b)…

A: The DNA is made of purines and pyrimidines. The purines are Adenine and Guanosine whereas the…

Q: Which of the following is true about the structure of DNA as proposed by Watson and Crick (B-form…

A: Introduction: Nucleic acids are large complex biomolecules that store hereditary information…

Q: Which of the following is not a feature of the DNA double helix?a. It obeys the AT/GC rule.b. The…

A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…

Q: A circular, double-stranded DNA contains 2100 base pairs. The solution conditions are such that DNA…

A: Linking number is the topological property of . Linking number is a total of twists and writhes. The…

Q: the contribution of Rosalind Franklin to the discovery of DNA's structure

A: To find The contribution of Rosalind Franklin to the discovery of DNA's structure

Q: b. What is the difference between the 3' and the 5' ends of a nucleotide chain? C. Do the chains run…

A: The double stranded helical structure of DNA (deoxyribonucleic acid) was first demonstrated by James…

Q: 1. The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 D. In your…

A: DNA (deoxyribonucleic acid) is a double helix structure that is made up of two intertwined…

Q: Which statement about nonpolar interactions in the formation of the DNA double helix is INCORRECT?…

A: Deoxyribose Nucleic Acid (DNA) is a nucleic acid that acts as the genetic material in all organisms…

Q: For entertainment on a Friday night, a genetics professor proposed that his children diagram a…

A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…

Q: 50 A The Backbone of the DNA molecule is made of which componere(s) of the nucleotide shown in the…

A: DNA stands for deoxyribonucleic acid which is made up of two strands of polynucleotide chains in a…

Q: In the Watson-Crick structure of DNA, the: a. adenine content of one strand must equal the thymine…

A: Watson and Crick model of DNA has two strands that wound around each other and form double hellicle…

Q: Examine the strand of DNA below. 3' CCTAGGCTGCAATCC5' 5'GGATCCGACGTTAGG3' An RNA primer is formed…

A: Here DNA templare strand is 3' - 5' . So RNA primer formed from 5' - 3' . Now primer sequence…

Q: Enzymes can break down the DNA catalyze the hydrolysis of the covalent bonds that join nucleotides…

A: Enzymes are biological molecules (typically proteins) that are vital for life and serve a wide range…

Q: base composition which contains 20% of the base adenine (A). (a) How many phosphor atoms are…

A: Hello. Since your question has multiple sub-parts, we will solve the first three sub-parts for you.…

Q: Which of the following statements DOES NOT apply to the Watson and Crick model of DNA? a. The two…

A: In 1953, J.D Watson and F.H.C Crick proposed the three dimensional model of DNA. According to this…

Q: Given the choices, a. 26 b. 23 c. 27 d. 21 how many hydrogen bonds are present in a DNA double…

A: The sequence is- GCTGTGCACT The complementary strand is- CGACACGTGA The rules of base pairing (or…

Q: , Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT…

A: Note- According to the guidelines, we are supposed to solve first three subparts (a, b and c) of a…

Q: What was the contribution of Rosalind Franklin to the discovery of DNA's structure? a.Discovery…

A: DNA is that the chemical name for the molecule that carries genetic directions altogether living…

Question

Indicate whether each of the following base-pairing

situations (1) involves two DNA strands, (2) involves a

DNA strand and an RNA strand, or (3) could involve

either two DNA strands or a DNA strand and an

RNA strand?

a. A G T

U C A

b. A C T

T G A

c. A G U

T C A

d. C G C

G C G

a. A G T

U C A

b. A C T

T G A

c. A G U

T C A

d. C G C

G C G

A22-97 Indicate whether each of the following base-pairing
situations (1) involves two DNA strands, (2) involves a
DNA strand and an RNA strand, or (3) could involve
either two DNA strands or a DNA strand and an
RNA strand?
а.
AGT
b.
АСТ
UCA
TG A
с.
AGU
d. CGC
ТСА
GC G

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .
⦁ Original: ATTTGAGCCMutated: ATTGAGCC. This is an example of what kind of mutation?
49. The actions of the mismatch repair system become especially critical in regions of DNA that carry ________________sequences. A. Deleted B. New C. Old D. Repeated E. Both A and D
13.Which lane or lanes on the gel could be the result of Mutation C?
On further analysis of the DNA described in conceptual questionC21, you discover that the triplex DNA in this alien organism iscomposed of a double helix with a third strand wound within themajor groove (just like the DNA in Figure shown). How would youpropose that this DNA is able to replicate itself? In your answer,be specific about the base-pairing rules within the double helixand which part of the triplex DNA would be replicated first.
What is the melting temp. of the following double-stranded DNA fragment CATCGCGATCTGCAATTACGACGATAA GTAGCGCTAGACGTTAATGCTGCTATT
A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) isconstructed, will its melting temperature be higher or lower?
Given the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’
10. DNA clones, derived via reverse transcription of mRNA molecules into DNA and cloned into a vector form a ?
List the steps in the correct order of DNA mismatch repair in E. coli Group of answer choices a. Mut S; Mut H; Mut L; Mut H cleaves unmethylated new DNA strand b. Mut H; Mut L; Mut S; Mut H cleaves unmethylated nascent DNA strand c. Mut H; Mut S; Mut L; Mut H cleaves unmethylated nascent DNA strand d. Mut L; Mut H; Mut S; Mut H cleaves unmethylated nascent DNA strand
List the steps in correct order of DNA mismatch repair in E. coli Group of answer choices Mut H; Mut L; Mut S; Mut H cleaves unmethylated nascent DNA strand MutH; MutS; Mut L; Mut H cleaves unmethylated nascent DNA strand MutL; MutH; MutS; Mut H cleaves unmethylated nascent DNA strand Mut S; Mut H; Mut L; Mut H cleaves unmethylated new DNA strand
Price et al. [(1999). J. Bacteriol. 181:2358–2362] conducteda genetic study of the toxin transport protein (PA) of Bacillusanthracis, the bacterium that causes anthrax in humans. Withinthe 2294-nucleotide gene in 26 strains they identified five pointmutations—two missense and three synonyms—among differentisolates. Necropsy samples from an anthrax outbreak in 1979revealed a novel missense mutation and five unique nucleotidechanges among ten victims. The authors concluded that thesedata indicate little or no horizontal transfer between differentB. anthracis strains. Question: Which types of nucleotide changes (missense or synonyms)cause amino acid changes?