A eukaryotic gene has two introns and three exons. The first intron closest to the promoter is 157 bp long and the second, farthest from the promoter, is 236. The three exons, in sequence from closest to farthest from the promoter, are 213 bp, 180 bp and 423 bp respectively. Draw the structure you would obtain if you hybridized the template strand of the transcribed region of this gene and three hundred base pairs of additional flanking DNA at each end with the mRNA produced from this gene. Can you estimate the size in amino acid residues of the protein coded for by this gene? Please justify you answer.

A eukaryotic gene has two introns and three exons. The first intron closest to the promoter is 157 bp long and the second, farthest from the promoter, is 236. The three exons, in sequence from closest to farthest from the promoter, are 213 bp, 180 bp and 423 bp respectively. Draw the structure you would obtain if you hybridized the template strand of the transcribed region of this gene and three hundred base pairs of additional flanking DNA at each end with the mRNA produced from this gene. Can you estimate the size in amino acid residues of the protein coded for by this gene? Please justify you answer.

Name: A eukaryotic gene has two introns and three exons. The first intron cl
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A eukaryotic gene has two introns and three exons. The first intron closest to the promoter is 157 bplong and the second, farthest from the promoter, is 236. The three exons, in sequence from closest tofarthest from the promoter, are 213 bp, 180 bp a

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

in the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3’-TACCACHTGGACTGAGGACTCCTCTTCAGA-5' What is the sequence for the partner strand?
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region. 4C. In NOT more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus?
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand?
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
The following represent deoxyribonucleotidesequences in the template strand of DNA:Sequence 1: 5'@CTTTTTTGCCAT@3'Sequence 2: 5'@ACATCAATAACT@3'Sequence 3: 5'@TACAAGGGTTCT@3'(a) For each strand, determine the mRNA sequencethat would be derived from transcription.(b) determine the amino acidsequence that is encoded by these mRNAs.(c) For Sequence 1, what is the sequence of the codingDNA strand?
The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1: 5′-CTTTTTTGCCAT-3′ Sequence 2: 5′-ACATCAATAACT-3′ Sequence 3: 5′-TACAAGGGTTCT-3′ (a) For each strand, determine the mRNA sequence that would be derived from transcription. (b) Using Figure 12–7, determine the amino acid sequence that is encoded by these mRNAs. (c) For Sequence 1, what is the sequence of the partner DNA strand?
The human gene for ß2 lens crystallin has the components listed below. The numbers represent nucleotidepairs that make up the particular component. Assumefor simplicity that no alternative splicing is involved.5′ UTR 1741st exon 1191st intron 5322nd exon 3372nd intron 14313rd exon 2083rd intron 3804th exon 4444th intron 995th exon 5463′ UTR 715Answer the following questions about the ß2 lenscrystallin gene, primary transcript, and gene product.Questions asking where should be answered with oneof the 11 components from the list or with None.Assume poly-A tails contain 150 As.a. How large is the ß2 lens crystallin gene in bp (basepairs)?b. How large is the primary transcript for ß2 lenscrystallin in bases?c. How large is the mature mRNA for ß2 lens crystallin in bases?d. Where would you find the base pairs encoding theinitiation codon?e. Where would you find the base pairs encoding thestop codon?f. Where would you find the base pairs encoding the5′ cap?g. Where would you find the base…
. The human gene for ß2 lens crystallin has the components listed below. The numbers represent nucleotidepairs that make up the particular component. Assumefor simplicity that no alternative splicing is involved.5′ UTR 1741st exon 1191st intron 5322nd exon 3372nd intron 14313rd exon 2083rd intron 3804th exon 4444th intron 995th exon 5463′ UTR 715Answer the following questions about the ß2 lenscrystallin gene, primary transcript, and gene product.Questions asking where should be answered with oneof the 11 components from the list or with None.Assume poly-A tails contain 150 As.a. How large is the ß2 lens crystallin gene in bp (basepairs)?b. How large is the primary transcript for ß2 lenscrystallin in bases?c. How large is the mature mRNA for ß2 lens crystallin in bases?d. Where would you find the base pairs encoding theinitiation codon?e. Where would you find the base pairs encoding thestop codon?f. Where would you find the base pairs encoding the5′ cap?g. Where would you find the base…
. The human gene for ß2 lens crystallin has the components listed below. The numbers represent nucleotidepairs that make up the particular component. Assumefor simplicity that no alternative splicing is involved.5′ UTR 1741st exon 1191st intron 5322nd exon 3372nd intron 14313rd exon 2083rd intron 3804th exon 4444th intron 995th exon 5463′ UTR 715Answer the following questions about the ß2 lenscrystallin gene, primary transcript, and gene product.Questions asking where should be answered with oneof the 11 components from the list or with None.Assume poly-A tails contain 150 As.a. How large is the ß2 lens crystallin gene in bp (basepairs)?b. How large is the primary transcript for ß2 lenscrystallin in bases?c. How large is the mature mRNA for ß2 lens crystallin in bases?d. Where would you find the base pairs encoding theinitiation codon?e. Where would you find the base pairs encoding thestop codon?f. Where would you find the base pairs encoding the5′ cap?g. Where would you find the base…
. The human gene for ß2 lens crystallin has the components listed below. The numbers represent nucleotidepairs that make up the particular component. Assumefor simplicity that no alternative splicing is involved.5′ UTR 1741st exon 1191st intron 5322nd exon 3372nd intron 14313rd exon 2083rd intron 3804th exon 4444th intron 995th exon 5463′ UTR 715Answer the following questions about the ß2 lenscrystallin gene, primary transcript, and gene product.Questions asking where should be answered with oneof the 11 components from the list or with None.Assume poly-A tails contain 150 As.a. How large is the ß2 lens crystallin gene in bp (basepairs)?b. How large is the primary transcript for ß2 lenscrystallin in bases?c. How large is the mature mRNA for ß2 lens crystallin in bases?d. Where would you find the base pairs encoding theinitiation codon?e. Where would you find the base pairs encoding thestop codon?f. Where would you find the base pairs encoding the5′ cap?g. Where would you find the base…