A gene encodes a protein with the following amino acid sequence: Met-Trp-His-Arg-Ala-Ser-Phe A mutation occurs in the gene. The mutant protein has the following amino acid sequence: Met-Trp-His-Ser-Ala-Ser-Phe An intragenic suppressor mutation restores the amino acid sequence to that of the original protein: Met-Trp-His-Arg-Ala-Ser-Phe Give at least one example of base changes that could produce the original mutation and the intragenic suppressor.

A gene encodes a protein with the following amino acid sequence: Met-Trp-His-Arg-Ala-Ser-Phe A mutation occurs in the gene. The mutant protein has the following amino acid sequence: Met-Trp-His-Ser-Ala-Ser-Phe An intragenic suppressor mutation restores the amino acid sequence to that of the original protein: Met-Trp-His-Arg-Ala-Ser-Phe Give at least one example of base changes that could produce the original mutation and the intragenic suppressor.

Name: A gene encodes a protein with the following amino acid sequence: Met-T
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: A gene encodes a protein with the following amino acid sequence: Met-Trp-His-Arg-Ala-Ser-Phe A mutation occurs in the gene. The mutant protein has the following amino acid sequence: Met-Trp-His-Ser-Ala-Ser-Phe An intragenic suppressor mutation restor

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 18QP: The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this...

See similar textbooks

Similar questions

A gene encodes a protein with the following amino acid sequence: Met-Trp-His-Arg-Ala-Ser-Phe A mutation occurs in the gene. The mutant protein has the following amino acid sequence: Met-Trp-His-Ser-Ala-Ser-Phe An intragenic suppressor mutation restores the amino acid sequence to that of the original protein: Met-Trp-His-Arg-Ala-Ser-Phe Give at least one example of base changes that could produce the original mutation and the intragenic suppressor. (Consult the genetic code in Figure 15.10.)
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 2: Met-Ser-Pro
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Gly
A portion of the coding sequence of a cloned gene is shown here:5΄–GCCCCCGATCTACATCATTACGGCGAT–3΄3΄–CGGGGGCTAGATGTAGTAATGCCGCTA–5΄This portion of the gene encodes a polypeptide with the aminoacid sequence alanine–proline–aspartic acid–leucine–histidine–histidine–tyrosine–glycine–aspartic acid. Using the method ofsite- directed mutagenesis, a researcher wants to change the leucinecodon into an arginine codon, using an oligonucleotide that is19 nucleotides long. What is the sequence of the oligonucleotidethat should be used? Designate the 5′ and 3′ ends of the oligonucleotidein your answer. Note: The mismatch should be in the middleof the oligonucleotide, and a 1-base mismatch is preferableover a 2- or 3-base mismatch. Use the bottom strand as the templatestrand for this site-directed mutagenesis experiment.
The genetic alteration responsible for sickle-cell anemia in humans involves: a transition mutation from A to G, substituting glutamic acid for valine in a-globin a transversion mutation from T to A, substituting valine for glutamic acid in b-globin a transition mutation from T to C, substituting valine for glutamic acid in b-globin a transversion mutation from G to C, substituting glutamic acid for valine in a-globin a frameshift mutation of one ATC codon, removing glutamic acid from b-globin
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. MMutant 4: Met-Ser-Pro-Glu-Gl
A double mutant produced by uneven crossing-over contains two single nucleotide mutations that result in frame shifts and are separated by about 20 base pairs. The first is an insertion, while the second is a deletion. The amino acid sequences of the wildtype and mutant polypeptide in this region of the protein are as follows: Wildtype: Lys – Lys – Tyr – His – Gln – Trp – Thr – Cys – AsnDouble Mutant: Lys – Gln – Ile – Pro – Pro – Val – Asp – Met – Asn a) What are the original and double mutant mRNA sequences. You may find it useful to use the conventional symbols Y for pyrimidine, R for purine, N for any nucleotide, and H for A,C, or T. 2. b) Which nucleotide was inserted? 3. c) Which nucleotide was deleted?
Two missense mutations in the gene that encodes an enzyme called superoxide dismutase cause a form of amyotrophic lateral sclerosis (ALS, or Lou Gehrig disease). This disease causes loss of neurological function over a 5-year period. One mutation alters the amino acid asparagine (Asn) to lysine (Lys). The other changes an isoleucine (Ile) to a threonine (Thr). List the codons involved and describe how single-base mutations can alter the specified amino acids.
Which of the following mutations in the protein-coding region of a gene is more likely to lead to complete loss of function of the encoded protein: an insertion of six nucleotides or a deletion of two nucleotides? Briefly explain your answer.
Based on the following wild type sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table). Wild Type: GUC GCC GAC GAG AGG Mutant 1: GUC GCC AGA CGA GAG G Mutant 2: GUC GCC ACG AGA GG Mutant 3: GUC GCC AAC GAG AGG Mutant 4: GUA GCC GAC GAG AGG Mutant 5: GUC GCC GAC UAG AGG
The mRNA sequence 5' AUG AAA CAG GGA UAA 3' encodes a particular peptide of interest to your research team. You have identified a new alternate allele of the sequence 5' AUG AAG CAG GGA UAA 3'. What type of mutation does this alternate sequence illustrate?