A geneticist discovers that two different proteins are encoded by the same gene. One protein has 56 amino acids, and the other has 82 amino acids. Provide a possible explanation for how the same gene can encode both of these proteins.

Q: If you were to compare the amino acid sequences of histone proteins across several distantly-related…

A: The histone proteins highly basic protein found in the nucleus of eukaryotic cells. They play a…

Q: What is the name given to study of biochemical nature of genes and how genes express their encoded…

A: Genes are the sequence of nucleotide bases present in the DNA in a cell. There are many genes in the…

Q: Is the sequence of amino acids in rubisco encoded by nuclear genes or not? Explain.

A: The enzyme rubisco stands for ribulose bisphosphate carboxylase/oxygenase. It acts as a key enzyme…

Q: A person treated successfully by gene therapy will still have a defective copy of the gene. Explain…

A: Genes are the basic unit of heredity. The study of heredity is called Genetics. The father of…

Q: What is the sequence of the first 10 nucleotides of the transcript of this gene? 5' 3'

A: Transcription is mainly the process of making RNA from gene sequence and transcript is the product…

Q: Mobile genetic elements, such as the Alu sequences, are found in many copies in human DNA. In what…

A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…

Q: Many aspects of gene function can be nicely explained with the one- gene-one-enzyme hypothesis,…

A: Genes are a set of instructions that determine what the organism is like, its appearance, how it…

Q: A molecular geneticist hopes to find a Gene in human liver cell that codes for an important…

A: In heredity, gene occupies the basic physical and functional unit. They are found to be composed of…

Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…

A: With the help of the Human Genome Project, it has now become possible to sequence all of the genes…

Q: What is a gene? Provide at least two different definitions and explain.

A: Gene is a segment of DNA (deoxyribonucleic acid) of an individual that is responsible for the…

Q: The b1 allele encodes a transcription factor that stimulates production of anthocyanin, a purple…

A: It is given that seven tandem repeats were deleted that are located 100,000 bp upstream of the b1…

Q: You have isolated a transposable element from the human genome and have determined its DNA…

A: Transposable element also known as jumping gene, is a DNA sequence which can change its position in…

Q: A geneticist is trying to determine how many genes are found in a 300,000-bp region of DNA. Analysis…

A: Deoxyribonucleic acid (DNA) is the genetic material. Nucleosome is the packaging unit in eukaryotes.…

Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…

A: A desired gene is defined as the insertion of  copies of the gene into the living cells in order to…

Q: Given a mutation in the promoter, coding region, and/or non-coding region of a gene, explain how…

A: The mutation is a sudden heritable change in the genetic makeup of a cell which mostly results in…

Q: Histones are proteins that control gene function by attaching through salt links to exterior regions…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: The anticodon of a particular tRNA molecule is    what is it called when heterozygous have a…

A: tRNA  The tRNA is an adaptor molecule which made up of RNA. the main function of tRNA molecule is to…

Q: What does the White gene code for?

A: Genes are the structural and functional units of heredity that carry coded genetic information in…

Q: If you were examining a sequence of chromosomal DNA, what characteristics would cause you to believe…

A: Step 1 The transposable element is a DNA (deoxyribonucleic acid) sequence that can change its…

Q: What are the functions of transcriptional activator proteins and repressor proteins? Explain how…

A: Transcription is the first step in central dogma of protein synthesis. It involves formation of…

Q: Explain Mutations in a gene are colinear with the sequence of amino acids in the encoded…

A: A change in DNA sequence is called Mutation. This may be a result of an error in DNA…

Q: Explain why it is sometimes difficult to locate genomic regions that encode a protein.

A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…

Q: One mutation is a deletion of six nucleotides in the second exon of the gene and the other mutation…

A: Introns and exons are nucleotide sequences within a gene in mRNA. The conversion of DNA to RNA is…

Q: do introns or 3′ untranslated regions of a gene have higher rates of nucleotide substitution?…

A: Introns are the regions that include non-coding regions of the RNA transcript. The introns are…

Q: What is dominant control mechanism of gene expression? explain the following image.

A: Dominant alludes to a connection between two adaptations of a gene. In case one is dominant, the…

Q: You are studying a mutation in mice, which acts dominantly. Mice that have only one copy of the…

A: Definition Mutations are changes in DNA sequence. it can result from DNA copying mistakes , made…

Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…

A: The nucleotides sequence of the small part of the gene of interest is GTGGACTGACA as given in the…

Q: Name four types of point mutations that can occur in a gene coding for a protein. Discuss the…

A: The DNA (deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Explain how exon shuffling can be due to unequal homologous recombination.

A: Exon shuffling is defined as a molecular process for the arrangement of new genes. It is a cycle…

Q: In humans, there may be three times as many proteins as genes. If each gene encodes a protein, how…

A: DNA gets condensed to form chromosomes during cell division. Chromosomes are rod shaped chromatin…

Q: Albinism is a condition where individuals can't make melanin pigment. The affected gene encodes for…

A: Albinism is a group of inherited disorders which can lead to no production of melanin pigment due to…

Q: Name the two types of mutagens, give an example for each, and briefly describe how they cause…

A: Mutation is any change in the DNA that results in abnormal behaviour of the DNA. There can be…

Q: What are the amino acids encoded by gene Z?

A: Given information The promoter is from the 20-55th position in the sequence. The ribosome binding…

Q: Please draw a diagram to show the genomic organization of a gene with three exons

A: mRNA is the transcript that is finally used as the template for protein synthesis.

Q: The following image depicts a short stretch of sequence associated with a gene. Which of the…

A: The given DNA strand is as follow 5'- AACTATAAGCCTTGGCCGATTCGATGCTAAATTGCGCATAA-3 We know DNA has…

Q: Explain why certain genes in eukaryotic cells are present in multiple copies.

A: Genes are expressed by the process of transcription and protein synthesis.

Q: Explain how a single base deletion in the middle of a gene would change the reading frame of that…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: What is the central dogma of biology? Describe the molecular processes that accomplish the flow of…

A: Central Dogma of Biology:                   The flow of genetic information from DNA to RNA which is…

Q: Place these events in the order they occur during mutagenesis:

A: Mutagenesis could be a method by that the genetic info of an organism is modified by the assembly of…

Q: Many aspects of gene function can be nicely explained with the one-gene-one-enzyme hypothesis, which…

A: It states that "a gene controls the synthesis of one enzyme". It was carried out using Neurospora…

Q: You are studying a small eukaryotic gene of about 2000 bp in length. About how many copies of…

A: There are histone octamers found in the genetic arrangement whose knowledge can be used to answer…

Q: a molecular geneticist hopes to find a gene in human liver cells that codes for an important…

A: As given in the question, there is a particular gene in the human liver cells that quotes for an…

Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′What topic in…

A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.