A molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. He knows that the nucleotide sequence of a small part of the gene is GTGGAСTGACA. Briefly explain how to obtain the desired gene.

A molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. He knows that the nucleotide sequence of a small part of the gene is GTGGAСTGACA. Briefly explain how to obtain the desired gene.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 10QP: What percentage of the DNA in the genome actually corresponds to genes? How much is actually...

See similar textbooks

Related questions

Q: What is the name given to study of biochemical nature of genes and how genes express their encoded…

A: Genes are the sequence of nucleotide bases present in the DNA in a cell. There are many genes in the…

Q: The word transcribe means “to write out.” The word translate means “to express in another language.”…

A: In another language, Transcribe means “to write out” Translate means “to express in”

Q: • Transposable elements are short segments of DNA, presentin multiple locations, that move around…

A: Genes are the basic structural and functional unit of heredity. They carry coded genetic information…

Q: If a single strand of a gene contains 678 bases, how many amino acids result in the polypeptide…

A: The biochemical substance that is carried from the preceding generation to the succeeding generation…

Q: A person treated successfully by gene therapy will still have a defective copy of the gene. Explain…

A: Genes are the basic unit of heredity. The study of heredity is called Genetics. The father of…

Q: a. Which gene is mutated in individuals with sickle-cell anemia? b. What are the major symptoms of…

A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…

Q: Two eukaryotic proteins have one domain in common but areotherwise very different. Which of the…

A: Eukaryotes are organisms whose cells have a nucleus enclosed within a nuclear envelope. Eukaryotes…

Q: If the DNA duplex for the beta chain of haemoglobin 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5' were…

A: Answer: TRANSCRIPTION = It is process of transcribing a strand of DNA using RNA polymerase which…

Q: Mobile genetic elements, such as the Alu sequences, are found in many copies in human DNA. In what…

A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…

Q: Suppose researchers learn that a particular congenital disease is caused by synthesis of a protein…

A: Recombinant DNA technology brings the the gene from multiple sources together and place it in the…

Q: A researcher was mutating prokaryotic cells by inserting segments of DNA. In this way, she made the…

A: a.) Mutant is the palindromic sequence for original construct. Palindromic sequences are those…

Q: The template strand of a gene has the sequence 5'- CTACCGCGCGGTGCTAGGGGCCAT-3' What is the third…

Q: A geneticist is trying to determine how many genes are found in a 300,000-bp region of DNA. Analysis…

A: Deoxyribonucleic acid (DNA) is the genetic material. Nucleosome is the packaging unit in eukaryotes.…

Q: You are studying the tryptophan synthetase gene that Yanofsky also examined to determine the…

A: Charles Yanofsky and colleagues in 1964 discovered that nucleic acid sequences and the translated…

Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…

A: A desired gene is defined as the insertion of copies of the gene into the living cells in order to…

Q: Histones are proteins that control gene function by attaching through salt links to exterior regions…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: Let’s suppose that a vertebrate organism carries a mutation that causes some cells that normally…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: If you were examining a sequence of chromosomal DNA, what characteristics would cause you to believe…

A: Step 1 The transposable element is a DNA (deoxyribonucleic acid) sequence that can change its…

Q: Discuss the following statement: “from the nucleotide sequence of a cDNA clone, the complete amino…

A: The proteins are the polymer of amino acids. They play an important role in the cell, by catalyzing…

Q: Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom…

A: The process of protein synthesis using the information in an organism's DNA is called central dogma…

Q: Explain why it is sometimes difficult to locate genomic regions that encode a protein.

A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…

Q: A geneticist discovers that two different proteins are encoded by the same gene. One protein has 56…

A: A gene is a stretch of nucleotides present in the DNA molecule. It encodes information for the…

Q: Suppose that a gene has a mutation that changes one nucleotide. Compared to the protein produced…

A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…

Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…

A: Alternative splicing is a process that enables a messenger RNA to direct the synthesis of different…

Q: Scientists have observed that individuals with LOW birthweight are MORE likely to become obese as…

A: The experiment performed to observed that individuals with LOW birthweight are MORE likely to become…

Q: Let us suppose that a vertebrate organism carries a mutation that causes some cells that normally…

A: The addition of methyl groups into DNA molecule is called DNA methylation. The activity of the DNA…

Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…

A: The nucleotides sequence of the small part of the gene of interest is GTGGACTGACA as given in the…

Q: When the human genome sequence was finally completed, scientists were surprised to discover that the…

A: Genetics is the branch of biology which deals with genes, heredity, and genome in the organism.…

Q: Name four types of point mutations that can occur in a gene coding for a protein. Discuss the…

A: The DNA (deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Explain How can you study the protein Z in the cancer cells?

A: In case of cancer, the activity of the hemostatic system components triggers tumor growth and…

Q: In humans, there may be three times as many proteins as genes. If each gene encodes a protein, how…

A: DNA gets condensed to form chromosomes during cell division. Chromosomes are rod shaped chromatin…

Q: Albinism is a condition where individuals can't make melanin pigment. The affected gene encodes for…

A: Albinism is a group of inherited disorders which can lead to no production of melanin pigment due to…

Q: Name the two types of mutagens, give an example for each, and briefly describe how they cause…

A: Mutation is any change in the DNA that results in abnormal behaviour of the DNA. There can be…

Q: A molecule geneticist hopes to find a gene in human liver cells that codes for an important…

A: As Only a partial sequence of the desired gene that codes for the blood clotting protein in liver is…

Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…

A: DNA is double-stranded, but only one strand serves as a template for transcription at any given…

Q: You isolate a mouse Tau-gene-containing DNA fragment from the chicken and hybridize it to the…

A: DNA: DNA is a polymer made up of two polynucleotide chains that coil around each other to form a…

Q: What sequence information about a gene is lackingin a cDNA library?

A: Genetics is the branch of biology, which deals with the study of genes, their pattern of…

Q: A mutant strain of bacteria is isolated in which the amino acid glutamine is often erroneously…

A: Answer of the question given below...

Q: What happens when one base pair of DNA is lost from the coding region of a gene because of mutation?…

A: This type of mutation is known as Deletion mutation in which a single or entire sequence of…

Q: A molecular geneticist hopes to find a gene gene in human liver cells that codes for an important…

A: Gene cloning is the process by which we can develop a cloned gene in molecular biotechnology.

Q: What is the survival value of the degeneracy of the genetic code? – Define what degeneracy means and…

A: Introduction :- The genetic code is made up of codons, which are three-letter nucleotide pairings…

Q: . Consider the genetic code for the amino acid phenylalanine (abbreviations: Phe, F) and single base…

A: A codon is the triplet sequence of DNA or RNA nucleotides which corresponds either to specific amino…

Q: You have a patient in your clinic presenting symptoms of cystic fibrosis. You screen their CFTR gene…

A: Cystic fibrosis is a disease in which there is excess mucus productions in the body such as lungs…

Q: Computer programmers, working with molecular geneticists, have developed programs that can identify…

A: Transcription is the process by which the information in a strand of deoxyribonucleic acid (DNA) is…

Q: You are studying the rate of transcription of a particular eukaryotic gene. When the DNA located…

A: Transcription is copy of genetic information from DNA to RNA. Eukaryotic transcription is more…

Q: What do you predict that you would find when comparing the mRNA and protein products of the mutated…

A: Spinal muscular atrophy(SMA) SMA is characterized by the loss of motor neurons, nerve cells in the…

Q: a molecular geneticist hopes to find a gene in human liver cells that codes for an important…

A: As given in the question, there is a particular gene in the human liver cells that quotes for an…

Q: Suppose we take tissue samples from the kidney and the liver of a healthy individual. If we compare…

A: Genetic sequences or the genome of a cell is present in the nucleus and includes DNA molecule…

Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′What topic in…

A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

Definition Definition A complex molecule that makes up a fundamental unit of a DNA or RNA molecule. Nucleotides are composed of a sugar, a nitrogenous base, and a phosphoric acid.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

If the genetic code used 4 bases at a time, how many amino acids could be encoded?
When the human genome sequence was finally completed, scientists were surprised to discover that the genome contains far fewer genes than expected. How many genes are present in the human genome? Scientists have also found that there are many more different kinds of proteins in human cells than there are different genes in the genome. How can this be explained?
If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
a molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. he knows that the nucleotide sequence of a small part of the gene is gtggactgaca. briefly explain how to obtain the desired gene answer
A molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain gene
A molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting. He knows that the nucleotide sequence of a small part of the gene is GTGGACTGACA. Briefly explain how to obtain the desired gene.
A molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. He knows that the nucleotife sequence of a small part of the gene is GTGGACTGACA. Briefly explain how to obtain the desired gene.
Suppose you are a research assistant in a lab studying dna-binding proteins. you have been given the amino acid sequences of all the proteins encoded by the genome of a certain species and have been asked to find candidate proteins that could bind dna. what type of amino acids would you expect to see in the dna-binding regions of such proteins?
You have isolated a transposable element from the human genome and have determined its DNA sequence. How would you use this sequence to determine the copy number of the element in the human genome if you just had a computer with an Internet connection? (Hint: see Chapter 14.)
Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can hybridize one of the strands of that gene to the mRNA for that gene by allowing the strands to hydrogen bond. Why did the appearance of these hybridized strands provide evidence of the existence of introns in eukaryotic genes?
If you know the sequence of amino acids in a protein, what does the genetic code table allow you to infer about the sequence of base pairs in the gene that specifies that protein?