A researcher was mutating prokaryotic cells by inserting segments of DNA. In this way, she made the following mutation:Original TTGACAT 15 to 17 bp TATAATMutant TATAAT 15 to 17 bp TTGACATa. What does this sequence represent?b. What do you predict will be the effect of such a mutation? Explain.

A researcher was mutating prokaryotic cells by inserting segments of DNA. In this way, she made the following mutation:Original TTGACAT 15 to 17 bp TATAATMutant TATAAT 15 to 17 bp TTGACATa. What does this sequence represent?b. What do you predict will be the effect of such a mutation? Explain.

Name: A researcher was mutating prokaryotic cells by inserting segments of D
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: A researcher was mutating prokaryotic cells by inserting segments of DNA. In this way, she made the following mutation:Original TTGACAT 15 to 17 bp TATAATMutant TATAAT 15 to 17 bp TTGACATa. What does this sequence represent?b. What do you predict wil

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 12TYU

See similar textbooks

Similar questions

You are studying the tryptophan synthetase gene that Yanofsky also examined to determine the relationship between the nucleotide sequence and the amino acid sequence of the gene. Yanofsky found a large number of mutations that affected the tryptophan synthetase gene. A) If you took this mutant E. Coli line (that has an Arginine at this location) and exposed it to a mutagen that could potentially change bases, what are the second mutations you would most likely discover that would restore the activity of the tryptophan synthetase gene and where would it be located? B) Most of the mutations that Yanofsky recovered were missense mutations. However, Yanofsky also recovered a nonsense mutation that changed amino acid number 15 into a stop codon. This codon normally encodes Lysine. Does the recovery of this mutation support the hypothesis that this Lysine residue is critical in the function of the tryptophan synthetase protein?
Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…
A mutant strain of bacteria is isolated in which the amino acid glutamine is often erroneously substituted for glutamic acid during protein synthesis. What kind of mutation might be underlying this defect? How could you test this hypothesis?
A researcher has isolated a restriction endonuclease that cleaves at only one particular 10- basepair site. Would this enzyme be useful in protecting cells from viral infections, given that a typical viral genome is 50,000 base pairs long? Explain.
Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can hybridize one of the strands of that gene to the mRNA for that gene by allowing the strands to hydrogen bond. Why did the appearance of these hybridized strands provide evidence of the existence of introns in eukaryotic genes?
A molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain gene
Consider this sequence below: GAG TAC ACG AGT GGA Which of the following options is an example of a non-synonymous point mutation? (remember to translate to mRNA!) A. GAG TAC AAT CGA GTG GA B. GAG TAC ACG GGT GGA C. GAG TAC A–G AGT GGA D. GAG TAC ACG AGA GGA
the one above: Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT 2. Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon. 3. How many amino acids were changed in the mutated polypeptide?
a molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. he knows that the nucleotide sequence of a small part of the gene is gtggactgaca. briefly explain how to obtain the desired gene answer
If the mutation causing Tay Sachs disease involves a C to T change at position 4 in the sequence AAGCGTTAGCTAGGCC, what probe would you use to detect the mutation in individuals concerned about carrying the disease?
What would be the most likely effect of a mutation at the following locations in an E. coli gene? a. -8 b. -35 c. -20 d. Start site
In studies of frameshift mutations, Crick, Barnett, Brenner, andWatts–Tobin found that either three nucleotide insertions ordeletions restored the correct reading frame. Question: Assuming the code is a triplet, what effect would the addition or loss of six nucleotides have on the reading frame?