Two eukaryotic proteins have one domain in common but areotherwise very different. Which of the following processes ismost likely to have contributed to this similarity?(A) gene duplication(B) alternative splicing(C) exon shuffling(D) random point mutations

Two eukaryotic proteins have one domain in common but areotherwise very different. Which of the following processes ismost likely to have contributed to this similarity?(A) gene duplication(B) alternative splicing(C) exon shuffling(D) random point mutations

Name: Two eukaryotic proteins have one domain in common but areotherwise ver
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Two eukaryotic proteins have one domain in common but areotherwise very different. Which of the following processes ismost likely to have contributed to this similarity?(A) gene duplication(B) alternative splicing(C) exon shuffling(D) random point mu

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can hybridize one of the strands of that gene to the mRNA for that gene by allowing the strands to hydrogen bond. Why did the appearance of these hybridized strands provide evidence of the existence of introns in eukaryotic genes?
A mutant strain of bacteria is isolated in which the amino acid glutamine is often erroneously substituted for glutamic acid during protein synthesis. What kind of mutation might be underlying this defect? How could you test this hypothesis?
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?
Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can hybridize one of the strands of that gene to the mRNA for that gene by allowing the strands to hydrogen bond. Why is it sometimes claimed that alternative splicing of exons from a single gene results in a set of proteins of related function?
a. If a single transition occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? b. If a single transversion occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? c. If a single transition occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence? d. If a single transversion occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?
A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′What topic in genetics does this question address?
The mutation associated with pancreatic cancer in the family in Figure23.1 was located in an exon of the palladin gene. In general, wouldyou expect to find more cancer-causing mutations in exons or inintrons? Explain your answer.
Do you think that the alternate splicing of exons may enable a structural gene to code for several isoproteins from one and the same gene?why so.
What is the consensus sequence of the following six DNA sequences?GGCATTGACTGCCATTGTCACGCATAGTCAGGAAATGGGAGGCTTTGTCAGGCATAGTCA
What is the concept of universality of the genetic code? What are the exceptions to this universality?
In a particular region of the genome of a certain bacterium, one DNA strand is transcribed to give rise to an mRNA for protein A and the other DNA strand is transcribed to give rise to an mRNA for protein B. a) Would there be any problem in expressing the two genes? 2. b) If a mutation occurred to affect the structure of protein A, what would you observe in the structure of protein B?