please help with both questions If the template strand of DNA has the sequence 5'AATGCCTATA3', the MRNA sequence that is transcribed will beO A 5°TTACGGATAT3'B 5'UUACGGAUAU3'C.5'UAUAGGCAUU3'OD.5'TATAGGCATT3' A major difference between prokaryotic and eukaryotic DNA replication mechanisms isboth leading and lagging strands are continuous in eukaryotes.no Okazaki fragments are made in eukaryotes.O B.C. the replication fork moves slower in eukaryotes.no primer synthesis is needed in eukaryotes.OD.

Transcription is the first of several steps in gene expression in which a particular segment of DNA…

Answered: If the template strand of DNA has the…

If the template strand of DNA has the sequence 5'AATGCCTATA3', the MRNA sequence that is transcribed will be OA 5TTACGGATAT3' B 5'UUACGGAUAU3' OC 5'UAUAGGCAUU3' OD.5'TATAGGCATT3'

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 5RQ: The initial mechanism for repairing nucleotide errors in DNA is _____. a. mismatch repair b. DNA...

See similar textbooks

Related questions

Q: A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:…

A: The Central dogma defines how DNA codes for proteins, which occur in three stages: replication,…

Q: AGGTATCGCAT is a sequence from the coding strand of a gene. What will bw the corresponding sequence…

A: The terms used in the question represents the molecules used during a gene expression. A gene is a…

Q: . List the sequences of RNA that would be transcribed template sequences. a. Ans:…

A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…

Q: List the sequences of the mRNA molecules transcribed from thefollowing template DNA sequences:a. T G…

A: The sequence of DNA that consists of genetic information is transcribed into RNA. The sequence…

Q: The first three codons for a mRNA sequence are 5’ GGC AAG UCU 3', What anticodons will the correct…

A: * mRNA that is also called as messenger ribonucleic acid is a single stranded RNA corresponds to…

Q: 5. A DNA sequence of "ACG" will code for the amino acid - (LS1- 1) * Second mRNA base C. UUU Phe UUC…

A: Gene expression refers to the complex, highly-regulated biological process, which involves the…

Q: If the DNA duplex for the beta chain of haemoglobin 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5' were…

A: Answer: TRANSCRIPTION = It is process of transcribing a strand of DNA using RNA polymerase which…

Q: Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA…

A: Transcription is process through which DNA is converted into mRNA.

Q: The template strand of DNA is 3’AGGATGCACGTAC5’ The sequence of the mRNA that is made from this DNA…

A: The RNA sequence would be same as coding strand (except thiamine is replaced by uracil) and opposite…

Q: If the sequence of DNA on the template strand of a gene is AAA,the mRNA codon produced by…

A: Transcription is the process of formation of RNA using the DNA template strand. Both strands of a…

Q: After sequencing a segment of DNA you identify the following sequence: 5…

A: Answer: DNA sequence : It is the genetic sequence or the order of nucleic acids in DNA. DNA…

Q: Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the…

A: Gene expression is the process by which the instructions in the DNA are converted to functional…

Q: I would like to know how you find the non-transcribed DNA sequence when you are given a 5 prime to 3…

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: The RNA is produced from the template strand of DNA by the transcription process that occurs within…

Q: Below is a template strand of DNA. Assume the transcription start site is outside of this sequence…

A: Transcription is the initial phase in gene expression, where data from a gene is utilized to develop…

Q: Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene:…

A: The double-stranded DNA molecule is made up of two DNA strands known as the template strand and the…

Q: Which of the following DNA strands, the top or bottom, would serve as a template for RNA…

A: Transcription is the process of making an RNA copy of a gene sequence. This RNA copy is called a…

A: The Central Dogma of Molecular Biology states that the genetic information stored in DNA is first…

Q: A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below. What is the…

A: A DNA sequence is transcribed to produce messenger RNA (mRNA) which is a link between DNA and…

Q: Given a non-template strand with this sequence: 3'- G CATCGCTAGCGGCTAGA-5' What will be the sequence…

A: The Maij difference between DNA and RNA is that DNA have bases A, T, G ,C where as RNA has A,U,G,C.…

Q: A template strand of DNA in a gene reads: ATGGCTGGGTGCTTTTAA. Using the codon chart provided, what…

A: The template DNA strand, from which the mRNA is synthesized is as follows, 5' ATGGCTGGGTGCTTTTAA3'…

Q: Which two sequences shown in the diagram are NOT directly transcribed from the template strand of…

A: ANSWER - in this figure the following sequences are not directly transcribed from the template…

Q: An mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start…

A: RNA (Ribo Nucleic Acid) is the genetic material found in prokaryotes and eukaryotes. It is the prime…

Q: Given the template DNA sequence: 3’ - TAC - CAG - GTT - ACC - ATC - 5’ A.) What will be the…

A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom…

A: The process of protein synthesis using the information in an organism's DNA is called central dogma…

Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?

A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…

Q: . Locate the -10 region hexanucleotide sequence in the following coding strand of DNA. Indicate…

A: Transcription is a process through which the template strand of the DNA transcribes into mRNA in the…

Q: Use the (non-template) DNA strand below to determine which is the promoter/sigma binding region:…

A: Introduction: A promoter is a DNA sequence to which proteins bind to start transcription of a single…

Q: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ a.Complementary Strand: b. Direct Transcript: c. Transcript for…

A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…

Q: If the sequence of the coding strand in a transcription unit is writtenas follows:5'…

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: What are the correct codons of the MRNA from the given DNA strand th needs to be transcribed? *…

A: Sense strand It is also called as the coding strand , plus strand or the non template strand. The…

Q: Below is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of…

A: Transcription is the process by which the information in a DNA strand (template) is copied into a…

Q: Given the following DNA sequence from the template strand of a given gene:…

A: Codon is a sequence of three nucleotides which together form a unit of genetic code in a DNA or RNA…

Q: SOURCE: GENERAL, ORGANIC AND BIOLOGICAL CHEMISTY by Smith 4th Edition

A: mRNA or messenger RNA is a polymer of ribonucleotides that has a sequence corresponding to the…

Q: For a TTT triplet of bases in the template sequence of DNA, the anticodon on the TRNA that binds the…

A: The anticodon is a trinucleotide sequence found on tRNA that controls which amino acid it…

Q: c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the…

A: Introduction :- In moelcular biology , the expression of gene is the most important event , that…

Q: Which of the following codons in an MRNA can be recognized by the tRNA with UAA anticodon sequence…

A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…

Q: A certain template DNA strand has the following nucleotide sequence:…

A: Nucleotides can be described as the nucleic acids’ building blocks. The two forms of nucleic acid…

Q: A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this…

A: During transcription, DNA information is transcribed into messenger RNA, which is then used to…

Q: Which of these choices represents one possible corresponding mRNA sequence that can be transcribed…

A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…

Q: What strand of mRNA would be synthesized from a template DNA strand with the sequence GATGTTTAC…

A: The information from the DNA is transferred to RNA by transcription. The information present in the…

Q: ction of a Gene AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following:…

A: AAG ATA CAG GCT CGG TAA : DNA

Q: The template strand (i.e.: the strand that is transcribed into RNA, which is usually represented “at…

A: Introduction: DNA is the genetic material that transfers from one to another except for some viruses…

Q: 6. [1] Given the DNA strand, GGACTGATT which of the following is its complementary mRNA? a CCTGACTAA…

A: Transcription Transcription is a process in which the DNA(deoxyribonucleic acid) is transcribed into…

Q: A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the…

A: Amino acids are the organic compounds that contain the amino group (–NH2) and carboxyl group(–COOH)…

Q: This type of mutation, where one nucleotide was replaced for another, is called a point mutation.…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: Following the 5-> 3' conversion of writing nucleotide sequence, indicate which of the following MRNA…

Question

please help with both questions

If the template strand of DNA has the sequence 5'AATGCCTATA3', the MRNA sequence that is transcribed will be
O A 5°TTACGGATAT3'
B 5'UUACGGAUAU3'
C.5'UAUAGGCAUU3'
OD.5'TATAGGCATT3'

A major difference between prokaryotic and eukaryotic DNA replication mechanisms is
both leading and lagging strands are continuous in eukaryotes.
no Okazaki fragments are made in eukaryotes.
O B.
C. the replication fork moves slower in eukaryotes.
no primer synthesis is needed in eukaryotes.
OD.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Trending now

This is a popular solution!

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

The initial mechanism for repairing nucleotide errors in DNA is _____. a. mismatch repair b. DNA polymerase proofreading c. nucleotide excision repair d. thymine dimers
Which of the following statements about the DNA replication is false? a. Synthesis of the new DNA strands is form 39 to 59 b.Synthesis of the new DNA strands is from 59 to 39 c. DNA Unwinds, primase adds RNA primer, DNA polymerases synthesize the new strand and remove the RNA primer d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite direction from the direction in which the replication for moves.
DNA replication is described as semi-conservative because _____. A. one leading strand and one lagging strand are produced in DNA replication B. all new DNA strands are synthesized continuously C. one new DNA strand is synthesized discontinuously D. DNA replication can never produce DNA molecules which consist of both original DNA stands E. one DNA strand is the template while the complementary strand is not
Which of the following statements about replication is false? The proofreading function of DNA polymerases involves 3’ 5’ exonuclease activity. Origins of replication are rich in G-C nucleotide pairs. A characteristic of aging cells is that telomeres become shorter. The lagging strand is synthesized in the opposite direction as the movement of the replication fork. DNA polymerase is more accurate that RNA polymerase.
Arrange the following events of DNA replication in the proper order. A. DnaA binds DNA B. DNA polymerase binds to a free 3’ – OH C. Topoisomerases act D. Ori “melts/denatures”
The elongation of leading strand during DNA synthesis a. progresses away from the replication fork. b. occurs in the 3'-5' direction c. does not require a template strand d. depends on the action of DNA polymerase
Which of the following is not a feature of eukaryotic DNA replication? a. Replication bubbles move in opposite directions.b. A new strand is synthesized using an old one as a template.c. Complementary base pairing determines which nucleotides will be added to the new strand.d. Each chromosome has one origin of replication.
At a growing replication fork, the replication of the two strands is: Question 15 options: continuous for the leading strand and discontinuous for the lagging strand. continuous for the lagging strand and discontinuous for the leading strand. uncoupled and independent of each other. discontinuous for both strands due to low processivity of the DNA polymerase.
For the statements below, indicate whether the statement applies to the leading strand, or to the lagging strand, or to both. a. synthesized in the 5'→3' direction b. synthesized continuously c. require(s) DNA ligase to join fragments d. described as a daughter strand e. synthesized in the same direction as the movement of the replication fork f. DNA polymerase is the enzyme involved in forming this polynucleotide.
Which of the following is NOT true of DNA replication? a. Helicase uses ATP as an energy source. b. Primase uses ATP to build primers. c. Single-stranded binding proteins are enzymes that hold the strands open. d. Telomerase adds nucleotides to the original DNA template. e. Ligase uses a condensation reaction to make a single phosphodiester bond at each site of ligation..
The elongation of the leading strand during DNA synthesis(A) progresses away from the replication fork.(B) occurs in the 3′ S 5′ direction.(C) produces Okazaki fragments.(D) depends on the action of DNA polymerase
Which of the following is not a true statement comparing prokaryotic and eukaryotic DNA replication? a. Both eukaryotic and prokaryotic DNA polymerases build off RNA primers made by primase. b. Eukaryotic DNA replication requires multiple replication forks, while prokaryotic replication uses a single origin to rapidly replicate the entire genome. c. DNA replication always occurs in the nucleus. d. Eukaryotic DNA replication involves more polymerases than prokaryotic replication.