A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin; the other was treated with cyanogen bromide. Given the following sequences (N- terminal to C-terminal) of the resulting fragments, deduce the sequence of the original peptide.
Q: Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first…
A: The deoxyribonucleic acid (DNA) is the hereditary material that transmits the genetic information…
Q: GCA UGC CGA UAC
A: 1. The tRNA anticodons for the amino acid sequence shown above is - GCA UGC CGA UAC
Q: Which of the following sequences is most likely to form a beta-turn? Explain why?…
A: The majority of proteins are globular in form. Thus, forming, turning, bending, or reorienting is…
Q: A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin;…
A: Trypsin is an endoproteolytic enzyme that cleaves at carboxylic end of the amino acids Lysine (Lys)…
Q: what is the c-terminal AA residue? use one-letter code for amino acid
A: The amino acid can be defined as the organic compound that comprises an amino group at one end and a…
Q: Write the consensus sequence for the following set of nucleotide sequences. AGGAGTT AGCTATT TGCAATA…
A: Genes are the structural and functional units of heredity. They carry coded genetic information in…
Q: threonine, alanine, and isoleucine. The TRNA anticodons for the amino acid sequence shown above is…
A: Protein synthesis or translation process takes place on the ribosomes with the help of messenger RNA…
Q: Consider the following 2 codons sequences. Codon sequence 1: ACU AGA GAU GUC UGC Codon sequence…
A: β-sheets are formed by adjacent parallel or antiparallel peptide strands that are hydrogen bonded in…
Q: Which of the following sequences is most likely to form an a helix?
A: An alpha helix is a sort of secondary structure, which describes how a protein's main chain is…
Q: The Shine-Dalgarno Sequence is used in bacteria eukaryotes both
A: The nucleotide segment at the 3' terminal of 16S ribosomal RNA (rRNA) has several pyrimidines with a…
Q: A sample of an unknown peptide was dividedinto two aliquots. One aliquot was treated with trypsin;…
A: Trypsin is an endopeptidase. It is a serine protease that cleaves after the basic residues such as…
Q: A peptide with 19 amino acid residues was digested with trypsin and generated the following…
A: The one letter code for different amino acids are :- G - glycine I - isoleucine R - arginine S -…
Q: It is possible for the codons for a single amino acid to have the first two bases in common and to…
A: mRNAs contain trinucleotide sequences known as codons. The ani-codon site of the tRNA recognizes the…
Q: To which synthetic family does each of the following amino acids belong? a. alanine b. phenylalanine…
A: Introduction: Depending on the chemical similarities of similar starting compounds, all of the amino…
Q: Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second…
A: The mRNA (messenger ribonucleic acid) is synthesized from a DNA (deoxyribonucleic acid) template.…
Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…
A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…
Q: A hexapeptide of unknown sequence was isolated from an amphibian skin then sequenced. The following…
A: Hi! Thanks for your question but the data are insufficient for solving the queries. I am writing…
Q: A sample of a peptide of unknown sequence was treated with trypsin; another sample of the same…
A: Trypsin is basically a serine protease where it hydrolyses proteins. It is synthesized in the…
Q: steps the Edman degration for amino acid sequencing both the N- and C- terminal analysis
A: Edman degradation is a method for sequencing of amino acids using specific biochemical compounds and…
Q: What would happen during an amino acid sequencing experiment using the Edman degradation if you…
A: The sequence of amino acids can be determined by using amino acids which are present in peptide and…
Q: A small section of bacterial enzyme has the amino acid sequence threonine, valine, glycine, and…
A: The process of formation of amino acids from the mRNA sequence is known as translation. mRNA…
Q: Please by using the first base of each as the first triplet in a condo, how do I translate two…
A: Translation Translation is the process in which the mRNA or messenger RNA is get translated. mRNA of…
Q: Shown below is a portion of a DNA sequence ( 31 base pairs long ) that encodes the last amino acids…
A: The process of synthesis of messenger RNA with the help of template DNA strand is called…
Q: How many possible nucleotide sequences could code for a peptide with the sequence "MRRTGERS*"? (Note…
A: The given sequence is 'MRRTGERS*'. The amino acid sequence is…
Q: A heptapeptide when treated with trypsin produced two peptides. T1 (D, G, Y) and T2 (K, F, V, A).…
A: Peptide includes a short chain of amino acids that are connected to each other by peptide bond. A…
Q: Find self-complementary regions in the following RNA sequence: AUGUGGCAUGCCAGG
A: Biomolecules includes carbohydrates, lipids, nucleic acids and proteins. Nucleic acid plays an…
Q: Assuming the genetic code is a triplet, what effect would the addition or loss of two nucleotides…
A: The process in which the messenger ribonucleic acid (mRNA) molecule sequence is translated to form…
Q: Why does RNA use uracil as a complementary base pair with adenine instead of thymine?
A: Ribonucleic acid (RNA) poses as genetic material but rarely takes part in…
Q: Although techniques are available for determining the sequences of amino acids in proteins, it is…
A: It is easier to sequence proteins indirectly by determining the base sequence of the gene for…
Q: Why would the initiater tRNA always be methionine ?
A: Initiator tRNA is the one which starts translation.
Q: How many different sequences of mRNA could encode a peptide with the sequence…
A: mRNA is decoded by the cells by reading their nucleotides in groups of three known as codons where…
Q: What would the peptide sequence be like after translation?
A: Translation is the process by which polypeptide or protein is produced from the mRNA by the help of…
Q: What method could be used to make an immobilised library of 6 different peptides, all differing by…
A: INTRODUCTION Peptide-based molecular probes identified by bacteriophage (phage) display technology…
Q: What amino acid sequence will be generated, based on the following DNA codon sequence? Did you read…
A:
Q: You are trying to determine the PTMs on your protein of interest, so you set up a mass spectrometry…
A: The modification of proteins after its biosynthesis is called post-translational modification (PTM).…
Q: Below is a sequence of DNA.…
A: Amino acids are the building blocks of proteins. The building blocks of life are amino acids and…
Q: For each of the following sequences, rank them in order (from best to worst) as sequences that could…
A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…
Q: The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a)…
A: The central dogma of molecular biology is the process of the formation of functional products by…
Q: A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin;…
A: Introduction Peptides Are Short Sequences of Amino Acid Monomers Joined by Amide Bonds That Occur…
Q: A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin…
A: Trypsin cleave the peptide on the carboxy side of arginine and lysine residues. Cyanogen bromide…
Q: With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the…
A: The process by which DNA gets converted into RNA molecule is called as transcription and then mRNA…
Q: After gel electrophoresis, it is common to extract a protein (or proteins) from a band in the gel,…
A: Hi! Thanks for your question. As you have posted multiple questions, we are answering the first…
Q: Which of the following RNA sequences is an inverted repeat and can form a stem-loop structure?…
A: A single-stranded nucleotide sequence followed by its reverse complement at the downstream is called…
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’, what is the sequence of the…
A: EXPLANATION: DNA utilizes four bases, adenine (A), guanine (G), cytosine (C), and thymine (T), in…
Q: If a tRNA molecule carries a glutamic acid, what are the two possible anticodon sequences that it…
A: An anticodon is a trinucleotide sequence that is complementary to that of a corresponding codon in…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin and the other was treated with cyanogen bromide. Given the following sequences (N-terminal to C-terminal) of the resulting fragments, deduce the sequence of the original peptide. Trypsin treatment Asn—Tyr—Asp—Met—Phe—Ala—Arg Asp—Trp—Asn—Arg Gln—Met—Tyr—Cys—Pro—Ile—Arg Gln—Cys Cyanogen bromide treatment Tyr—Cys—Pro—Ile—Arg—Asn—Tyr—Asp—Met Asp—Trp—Asn—Arg—Gln—Met Phe—Ala—Arg—Gln—CysA sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin, and the other with cyanogen bromide. Given the following sequences of the resulting fragments, deduce the sequence of the original peptide. Trypsin treatment: Asn-Thr-Trp-Met-Ile-Lys Gly-Tyr-Met-Gln-Phe Val-Leu-Gly-Met-Ser-Arg Cyanogen Bromide treatment: Gln-Phe Ile-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-MetThe following steps were performed using enzyme cleavage of a peptide to determine its amino acid sequence. Step 1. FDNB yield DNB-Gly Step 2. Treatment with trypsin yield 3 fragments: Tyr-Leu-Asp-Arg; Gly-Ser-Ala-Lys; Trp-Gly-Ser-Met Step 3. Treatment with pepsin gave the same 3 peptide fragments. What is the sequence of the peptide?
- A sample of a peptide of unknown sequencewas treated with trypsin; another sample of the same peptide wastreated with chymotrypsin. The sequences (N-terminal to C-terminal)of the smaller peptides produced by trypsin digestion were as follows:A polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly Ala-Ala-Gly-Leu-Trp-Arg Arg-Asp-Pro-Gly-Lue-Met-Val-Leu-Tyr-Ala-Ala-Asp-Glu-Lys And the following fragments are produced by chymotrypsin fragmentation: Ala-Ala-Gly-Leu-Trp Arg-Arg-Asp-Pro-Gly-Leu- Met-Val-Leu-Tyr Ala-Ala-Asp-Glu-Lys-Val-Gly What is the sequence of the whole original polypeptide?A polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly Ala-Ala-Gly-Leu-Trp-Arg Arg-Asp-Pro-Gly-Lue-Met-Val-Leu-Tyr-Ala-Ala-Asp-Glu-Lys And the following fragments are produced by chymotrypsin fragmentation: Ala-Ala-Gly-Leu-Trp Arg-Arg-Asp-Pro-Gly-Leu- Met-Val-Leu-Tyr Ala-Ala-Asp-Glu-Lys-Val-Gly What is the sequence of the whole original polypeptide? (Recall that trypsin cleaves a polypeptide backbone at the C-terminal side of Arg or Lys residues, whereas chymotrypsin cleaves after aromatic amino acid residues).
- A polypeptide is cleaved into peptides by treatment with trypsin and cyanogen bromide, and then the peptides are purified and sequenced. The sequences of the peptides are shown below. Trypsin peptides Cyanogen bromide peptides Based on sequences of the overlapping peptides generated by treatment with trypsin and cyanogen bromide (shown above), which of the following peptides represents the N-terminus of the original polypeptide? A. T-1 B. T-4 C. C-2 D. C-4 T-1 FENYAT-2 ELIMVPKT-3 NFEEGSKT-4 ITGLAIHQKT-5 GSMDPVALMTLR C-1 DPVALMC-2 VPKGSMC-3 ITGLAIHQKELIMC-4 TLRNFEEGSKFENYAWhich of the following would be considered a severe mutation? A) Leucine (Leu) > Lysine (Lys) B) Arginine (Arg) > Lysine (Lys) C) Histidine (His) > Arginine (Arg) D) Aspartic Acid (Asp) > Glutamic acid (Glu) E) Valine (Val) > Isoleucine (Ile)A peptide containing 18 amino acid residues in its sequence was partially hydrolyzed and peptides A–D were detected in the resulting mixture. Draw the sequence of the original peptide.A Phe-Gly-AlaB Ser-Ser-Ser-Trp-Phe-Gly-AlaC Phe-Phe-Met-Ala-Ala-Pro-Trp-CysD Met-Ala-Ala-Pro-Trp-Cys-Leu-Ile-Leu-Ser-Ser
- Digestion of a peptide with trypsin generates two smaller peptide products: methionine-glycine and tyrosine-lysine. Digestion of the same peptide with cyanogen bromide (CNBr) also generates two smaller peptide products: glycine and tyrosine-lysine-methionine. What is the sequence of the original peptide? a.) tyrosine-lysine-methionine-glycine b.) methionine-glycine-tyrosine-lysine c.) glycine-tyrosine-lysine-methionine d.) tyrosine-glycine-methionine-lysineWhich of the following amino acid sequences would yield the most optimal oligonucleotide probe? Ala-Met-Ser-Leu-Pro-Trp Gly-Trp-Asp-Met-His-Lys Cys-Val-Trp-Asn-Lys-Ile Arg-Ser-Met-Leu-Gln-AsnThe sequence of a 29 aa long peptide can be determined from the following data: Treatment of the peptide with dansyl chloride reveals that the amino-terminal is Val. Trypsin digestion, separation of peptides, and Edmann technique give the sequences for peptide fragments as follows: T-1 V-G-A-H-A-G-E-Y-G-A-E-A-T-E T-2 A-A-W-G-KT-3 V-L-S-P-A-K T-4 T-N-V-K