Which of the following sequences is most likely to form an a helix?
Q: Fill in the space _____________ repeats are structural motifs found in many proteins, and they…
A: Beta pleated sheet is the correct answer
Q: Which of the following sequences is most likely to form a beta-turn? Explain why?…
A: The majority of proteins are globular in form. Thus, forming, turning, bending, or reorienting is…
Q: Given the sequence shown below, write the complementary DNA sequence, using the base-pairing rules,…
A: DNA (Deoxyribonucleic acid) and RNA (Ribonucleic acid) are two examples of nucleic acids. DNA and…
Q: Write the consensus sequence for the following set of nucleotide sequences. AGGAGTT AGCTATT TGCAATA…
A: Genes are the structural and functional units of heredity. They carry coded genetic information in…
Q: A double-stranded molecule of B DNA contains 340 nucleotides. How many complete turns occur in this…
A: DNA duplex model proposed by Watson and Crick is right-handedly coiled and is called B-DNA. A DNA…
Q: When proteins recognize and bind to a specific sequence in DNA, why do they usually just recognize…
A: DNA binding proteins are proteins that bind to single or double stranded DNA generally in the major…
Q: . The base sequence T–G–C–A can be paired with the base sequence ___________ in a double-helix…
A: DNA is a double-helical nucleic acid and serves as genetic material.
Q: An RNA molecule has the following percentages of bases: A = 23%, U = 42%, C = 21%, and G = 14%. a.…
A: Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles in coding,…
Q: How many different sequences are possible for a tripeptide containing one molecule of valine, one…
A: Valine is a nonpolar amino acid with aliphatic R groups, represented by V. Glycine is the simplest…
Q: Which of the following is not a characteristic of codon?
A: In this question, we have to explain which statement is not correct about the characteristics of…
Q: The compound known as nitrous acid is a reactive chemical that replaces amino groups (−− NH2) with…
A: The given compound nitrous acid substitutes the cytosine(C) with uracil (U) and adenine (A) with…
Q: List 4 key differences between the alpha-helix and beta sheet forms of the secondary structure.
A: The proteins consist of a level of structural organization that includes a primary, secondary,…
Q: Describe the three forms that a double helix can assume.
A: DNA is the genetic material in almost all organisms. DNA is present in a double-helical form in all…
Q: Which of the following DNA sequence pairs are completely complementary?
A: The above given statement is about DNA complementary sequence.
Q: Describe how bases interact with each other in the double helix.This description should include the…
A: The building blocks of nucleic acids are nucleotides and in DNA they are called…
Q: The Watson-Crick double helix is: O a. a. primary structure O b. tertiary structure O c. quaternary…
A: Nucleic acids are considered biomolecules that are very long threads of polymers. It is made up of a…
Q: Which of the following best describes a stop codon?
A: Stop Codons constitute of three nucleotide sequence of m-RNA that doesn't code for any amino acid.…
Q: How many bases make up a codon?
A: The flow of genetic information from DNA to mRNA to proteins is central dogma where the process of…
Q: What is the nucleotide sequence of the complementary strand of the DNA molecule:…
A: Nucleic acids are large macromolecules that store hereditary information for cellular growth and…
Q: Which statement is true regarding an a helix,
A: There are two most common types of secondary protein structures: a. alpha helix…
Q: Why are GC and AT the only base pairs permissible in the double helix?
A: Base pair: The nucleotides on opposite strands of DNA double helix, that form chemical bonds…
Q: Why does RNA use uracil as a complementary base pair with adenine instead of thymine?
A: Ribonucleic acid (RNA) poses as genetic material but rarely takes part in…
Q: If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following…
A: The nitrogenous bases of two polynucleotides in a DNA molecule are linked through hydrogen bonds…
Q: Given the structures of the nitrogenous bases shown in the picture, draw the structure of a part of…
A: The nitrogenous bases shown in the figure are Adenine (A), Guanine (G), cytosine (C), uracil (U) and…
Q: For the RNA sequence AUUGGCAUCCGAUAA, draw the secondary structure that maximizes its base pairing.
A: RNA molecules usually come as single strands but when left in the environment, they fold themselves…
Q: Which of the following single-stranded DNA sequences is most likely to form a stem-loop structure?…
A: Double-stranded DNA consists of two polynucleotide chains each strand having a phosphodiester…
Q: specific base pairing essential to the processes of transcription and translation?
A: Transcription is the process by which an RNA copy of a gene sequence is created. This copy, known as…
Q: Each of the following sequences has a total of 20 nucleotides (note that the first six are the same…
A: Introduction Stem-loop formation occurs in single-stranded RNA when two regions of the same strand…
Q: Why do think nucleotides are also sometimes referred to as “bases” or “nucleotide bases”? What is…
A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: Compare the codons with a pyrimidine, either U or C, as the second base. Do the majority of the…
A: Codons are the trinucleotide sequence of DNA or RNA that codes for specific amino acids. There are…
Q: Given the following sequence, what secondary structure does it most likely prefer, and where in a…
A: The amino acids are the smallest subunit or monomer of the proteins. These amino acids are…
Q: What type of bonding is responsible for the formation of the two types of secondary structures?
A: Introduction: Depending upon the degree of complexity and type of bond involved in the formation of…
Q: To create a DNA:RNA hybrid from a short stretch of DNA with the sequence 5'-GGCTAAGTATGCCTAGTAGC-3',…
A: DNA: RNA hybrid are the structures that are formed between the newly synthesized RNA and the dsDNA.…
Q: write the structure of the following nucleotides: 1. 5'-dGMP 2. 5'-dGDP 3. 5'-dGTP 4. 5'-GTP 5.…
A: The nucleotides are the phosphoric acid esters of nucleosides with the phosphate at the C-5'…
Q: For the m-RNA nucleotide codons given below, what is the corresponding sequence of amino acids?…
A: mRNA is also called as messenger molecule which is produced by RNA polymerase. The mRNA is produced…
Q: hat will be the order of amino acids derived from the following DNA sequence 5’-TGATCGCACAAT-3’?…
A: introduction
Q: Like a helices, B sheets often have one side facing the surface of the protein and one side facing…
A: Alpha-helices and beta-sheets are examples of protein secondary structures. Secondary structure…
Q: Draw the structure of a G ∙ U base pair.
A: A base pair is the fundamental unit of double stranded nucleic acids consisting of two nucleobases…
Q: What is the difference between the 3′ end and the 5′ end of a polynucleotide?
A: The genetic material is composed of a polynucleotide chain that exhibits the nucleotides, which are…
Q: We are given a random DNA sequence (each of the 4 bases has equal probability of occurring at each…
A: As you have posted multi-part question.I am answering only first 3. For remaining answers post them…
Q: Explain why the phosphate group is located at the outer part of the double helix, whereas, the…
A: Asked : DNA structure explanation.
Q: Using the concept of complementary base pairing, write the complementary DNA strands, with their 5'…
A: The DNA molecule generally has two strands that wind around one another to form a shape is generally…
Q: List three factors that do not foster a-helix formation.
A: Proteins are one of the major macromolecules that contain long chains of amino acids. The structure…
Q: Hairpins may form at palindromic sequences in single strands of either RNA or DNA. How is the…
A: DNA and RNA are the two types of nucleic acids.
Q: Why does RNA form A-form helices and not B-form?
A: Nucleic acids are polymers made of nucleotides. Nucleotides are formed of nucleoside and phosphate…
Q: Describe the helix-turn-helix (HTF) motif?
A: Protein molecules are 3D structures made one or more of polypeptide chains. The linear sequence of…
Q: Draw the stem-loop structure and the homodimer structure this RNA sequence (GGCCCUUUUCAGGGCC) can…
A: Single-stranded RNA (ribonucleic acid) having regions of complementary ribonucleotides can form…
Q: Give two reasons to explain why a proline residue in the middle of an αhelix is predicted to be…
A: Proline is an organic acid classed as a proteinogenic amino acid contains a secondary amine.
Q: In the DNA double-helix structure, the larger of the two grooves formed by the helical twist where…
A: DNA is composed of nucleotides which form its building blocks. Each nucleotide comprises a…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What amino acids are encoded by this sequence?
- Which of the following sequences on a DNA moleculewould be complementary to GCTTATAT?a. TAGGCGCGb. ATCCGCGCc. CGAATATAd. TGCCTCTCFrom the following DNA strand: AAGCTAGGATTGCC How many codons would be present?5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following amino acid sequence: ILLLSESS Which DNA codon represents I (isoleucine)? a) 5' TCC 3' b) 5' TAG 3' c) 5' ATC 3' d) 5' CCT 3'
- A nontemplate strand of bacterial DNA has the following base sequence. What amino acid sequence will be encoded by this sequence? 5′ –ATGATACTAAGGCCC–3′What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.. The base sequence T–G–C–A can be paired with the base sequence ___________ in a double-helix configuration.
- Which of the molecules of RNA is the most likely to fold into a specific structure as a result of intramolecular (within itself) base-pairing? Explain. 5′-CCCUAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUAGGG-3′ 5′-UGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG-3′ 5′-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3′ 5′-GGAAAAGGAGAUGGGCAAGGGGAAAAGGAGAUGGGCAAGG-3′Which of these single strand RNA sequences could form a hairpin secondary structure? 5' AAAAAAAAAAAAAAAAAAA 3' 5' ACACACACACACACACAC 3' 5' CCCGGGGUUUUCCCCGGG 3' 5' UUUUUUUUUCCCCCCCCC 3' 5’ UUUGGGUUUGGGUUUGGG 3’What amino acids do the following sequences code for?(a) AUC (b) GCU (c) CGA (d) AAG
