A short RNA molecule was isolated that demonstrated a hyperchromic shift indicating secondary structure . Its sequence was determined to be 5'@AGGCGCCGACUCUACU@3' If the molecule were a tRNA fragment containing a CGAanticodon, what would the corresponding codon be?

A short RNA molecule was isolated that demonstrated a hyperchromic shift indicating secondary structure . Its sequence was determined to be 5'@AGGCGCCGACUCUACU@3' If the molecule were a tRNA fragment containing a CGAanticodon, what would the corresponding codon be?

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1CT

See similar textbooks

Related questions

Q: Examine the following base sequence – 5’ UGA 3’. It represents the anticodon region of a particular…

A: Answer - This tRNA would carry the amino acid Serine to the ribosome. mRNA carries codon. tRNA…

Q: How does a eukaryotic ribosome select its start codon? Describe the sequences in eukaryotic mRNA…

A: The process in which eukaryotic ribosome selects its start codon is a part of translation.…

Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′Make a drawing.

A: RNA stands for ribonucleic acid. It is a complex compound comprising of high molecular weight and…

Q: A TRNA molecule with the anticodon UGC would be carrying the amino acid: Second base of codon…

A: tRNA brings its amino acid to the mRNA in a specific order. This specific order can be determined by…

Q: UUU UUC UUA UCU) UCC UÇA UCG UAU Tyr UACS Phe UGU U Ser UGC Cys UUG Leu UAA Stop UGA Stop A UAG Stop…

Q: DNA in human mitochondria encodes 22 different tRNA molecules. However, 32 different tRNA molecules…

A: Mitochondrial gene expression maintain cellular homoeostasis. Mitochondrial gene expression is…

Q: Name the GREEN structure of the tRNA Variable loop D-loop Anticodon loop Pseudouridine loop

A: According to the messenger RNA (mRNA) nucleotide sequence, transfer RNAs (tRNAs), also known as…

Q: A glycine residue is in position 210 of the tryptophan synthetase enzyme of wild-type E. coli. If…

A: Single base substitutions in which change in only one base pair occurs.

Q: Suppose an mRNA transcript with the following base sequence reaches a ribosome: 5'-…

A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA that codes for a specific…

Q: CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5

A: Genetic codes are read in the form of triplets.first we will convert them to the triplets and then…

Q: Describe the anticodon of a single tRNA that could recognize the codons 5′–AAC–3′ and 5′–AAU–3′.…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: What molecular biology strategy can best be used to determine Failure of t-RNA to bind at the A site…

A: In prokaryotes, transcription and translation occur simultaneously as generation time is 20…

Q: Some mitochondria use a second codon, in addition to AUG, to specify Met. Which codon(s) is (are)…

A: A codon refers to a specific sequence of deoxy ribonucleotide (DNA) or ribonucleic acid (RNA), which…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…

Q: . The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…

A: Arginine is coded by six mRNA codons.

Q: Remembering that the wobble base of the tRNA is the5′ base of the anticodon:a. In human tRNAs, what…

A: The anticodon of transfer ribonucleic acid is used for carrying the amino acids from the amino acid…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: A ribosome is a biological unit made up of RNA and protein that functions as the cell's protein…

Q: The wobble rules for tRNA-mRNA pairing are shown. If we assume that the tRNAs do not containmodified…

A: The pairing of tRNA anticodon with mRNA codon lead from the 5’ end of codon. The first 2 position…

Q: The following segment of DNA in a hypothetical model organism encodes a polypeptide containing SEVEN…

A: Francis Crick proposed central dogma. The RNA is formed from DNA with the help of enzyme RNA…

Q: How does a eukaryotic ribosome select its start codon? Describe the sequences in eukaryotic mRNAs…

A: The biological mechanism by which messenger RNA is translated into proteins in eukaryotes is known…

Q: What polypeptides would be formed from the sequence UCAATGGGGUUUAUAGCG… (there are bases after the…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: Consider the following wild-type and mutant sequences:Wild-type ....CTTGCAAGCGAATC....Mutant…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: In eukaryotic cells, mRNAs have been found to have a circular arrangement in which proteins hold the…

A: In the context of cell biology, the rate of mRNA translation into cellular proteins called…

Q: From this overall anticodon sequence in tRNA,…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: Ribosomes are the protein synthesizing machinery present in a cell. A protein is synthesized during…

Q: Consider the tryptophan codon 5′ - UGG - 3′ in the standard genetic code . Can a single base change…

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: The free energy of binding of codon on mRNA and anticodon on tRNA is -9 kT. What is the probability…

A: In thermodynamics, free energy is the function of internal energy, entropy, and enthalpy. The…

Q: The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…

A: Mutation is the alteration in the genome sequence. It can occur in the genetic code of eukaryotes,…

Q: The wobble pairing rule states that a 'U' in teh anticodon wobble position can pair with 'A' or 'G',…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: For the RNA sequence AUUGGCAUCCGAUAA, draw the secondary structure that maximizes its base pairing.

A: RNA molecules usually come as single strands but when left in the environment, they fold themselves…

Q: Suppose the following peptide chain was attached to a gly -tRNA during translation : met -leu-asp…

A: Serine will be added next to glycine in the growing peptide chain through formation of a peptide…

Q: Some RNA molecules are covalently modifi ed by methylation at the N6 position in adenosine residues.…

A: Methylation of DNA is a process of covalent modification, in which at the adenosine nitrogenous…

Q: In prokaryotic protein synthesis, Nformylmethionine (fmet) is the first amino acid incorporated,…

A: Introduction: The process of protein synthesis from mRNA is called translation. The process of…

Q: ) Identify the current stage of the translation process shown in Figure 1 and name the anticodon…

A: Translation is a orocess in which mRNA produce protein by the help of ribosome and tRNA.there are…

Q: Assuming that each nucleotide is 0.34 nm long in mRNA, howmany triplet codes can simultaneously…

A: Nucleotide : It is an organic molecule that is the building block of DNA and RNA. They also have…

Q: From this overall anticodon sequence in tRNA,…

A: Anticodon present on the tRNA and it is read in the direction 3'→5' which is complementary to the…

Q: Describe how the base pairing between the Shine–Dalgarno sequence and the 30S subunit provides a…

A: The translation represents the process of protein synthesis by which the base sequence of the mRNA…

Q: A short RNA molecule was isolated that demonstrated a hyperchromicshift , indicating secondary…

A: Answer- The formation of mRNA from the coding strand of the DNA is called translation. It happens in…

Q: A. What amino acid sequence is encoded by the codon sequence AUAAUGGUAACGGUU? B. Suppose the codon…

A: DNA is the carrier of genetic information in almost all organisms except certain RNA viruses such as…

Q: By base-pair substitution, what are all the synonymouschanges that can be made starting with the…

A: The example of CGG is RNA codon which transiently binds with the transfer RNA by simple base pairing…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: A ribosome is a biological unit made up of RNA and protein that functions as the cell's protein…

Q: Diagram the likely secondary structure of an RNA with the sequence

A: The secondary structure of RNA is referred to as the folding of a single polynucleotide sequence of…

Q: Which amino acid would you expect a tRNA to be charged with if the TRNA has the anticodon 3' CUG 5'?…

A: Amino acids are biomolecules synthesized by the process of transcription and translation and form…

Q: Bacterial messenger RNAs usually contain many AUG codons. How does the ribosome identify the AUG…

A: AUG codon codes for methionine. It is the initiation codon that helps in initiating the translation…

Q: The tRNA anticodon sequence 3’GAG 5’ is charged with the amino acid leucine. This anticodon may pair…

A: Normal complementary nucleic acid sequences bind to each other by Watson and Crick base pairing but…

Q: Position on the small and large ribosomal subunits which the peptidyl-tRNA occupies prior to peptide…

A: The DNA (deoxyribonucleic acid) is the genetic material of an organism. The DNA is transcribed to…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: Central dogma of life involves gene expression, or the flow of genetic information from genes to…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: The start codon is the first codon of an mRNA (messenger RNA ) transcript translated by a ribosome.…

Q: Determine the sequence of amino acids specified by the codons in the following information strand.…

Q: Using the genetic code table, find the sequence of amino acids coded by the 2 DNA sequences (documi…

A: Transcription is the process by which the genetic information in the DNA segment is copied into an…

Concept explainers

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.

Question

A short RNA molecule was isolated that demonstrated a hyperchromic shift indicating secondary structure . Its sequence was determined to be

5'@AGGCGCCGACUCUACU@3'

If the molecule were a tRNA fragment containing a CGA
anticodon, what would the corresponding codon be?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Describe how the base pairing between the Shine–Dalgarno sequence and the 30S subunit provides a mechanism for distinguishing a start codon from a methionine codon. What is the eukaryotic version of this mechanism?
From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using THREE-letter amino acid code starting from N-terminus to C-terminus.
From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' Using ONE-letter amino acid code starting from N-terminus to C-terminus, what is the amino acid sequence that will be coded for?
For the anticodon sequences 5' IAA, consider the DNA sequence of the gene encoding the tRNA, what is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? Be sure to indicate polarities.
One of the codons in mRNA that specifies the amino acid phenylalanine is UUC. What is the anticodon on the tRNA that carries phenylalanine?
Several experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAi Met were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ –CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra amino acids, and others contained fewer amino acids than normal. a. What do these results indicate about how the ribosome recognizes the starting point for translation in eukaryotic cells? Explain your reasoning. b. If the same experiment had been conducted on bacterial cells, what results would you expect? c. Explain why some of the proteins produced contained extra amino acids while others contained fewer amino acids than normal
For the anticodon sequences 5' IAA and 5' xm^3s^2UAA, considering the DNA sequences of the genes encoding the tRNAs(assuming both tRNAs exist even if that is not true), What is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? be sure to indicate polarities.
Several experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAiMet were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra aminoacids, and others contained fewer amino acids than normal. a. What do these results indicate about how the ribosome recognizes the starting point for translation in eukaryotic cells? Explain your reasoning. b. If the same experiment had been conducted on bacterial cells, what results would you expect? c. Explain why some of the proteins produced contained extra amino acids while others contained fewer amino acids than normal.
Several experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAiMet were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ –CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra amino acids, and others contained fewer amino acids than normal. Q. What do these results indicate about how the ribosome recognizes the starting point for translation in eukaryotic cells? Explain your reasoning.
Several experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAiMet were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ –CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra amino acids, and others contained fewer amino acids than normal. Q. If the same experiment had been conducted on bacterial cells, what results would you expect?
The wobble rules for tRNA-mRNA pairing are shown. If we assume that the tRNAs do not containmodified bases, what is the minimum number of tRNAs needed to recognize the codons for the following types of amino acids? A. Leucine B. Methionine C. Serine
What RNA base sequence is complimentary to the following DNA base sequence 5'-CATGATTAT-3'? Using the table of codons, give the primary structure of the protein coded for by the RNA sequence: 5’-CCA CGA GGG GAG ACU UAA-3’?