Using the genetic code table, find the sequence of amino acids coded by the 2 DNA sequences (documi Assume that the mature functional protein (casein) contains 680 amino acids. How many codons of the m-RNA code for this protein? Justify.

Using the genetic code table, find the sequence of amino acids coded by the 2 DNA sequences (documi Assume that the mature functional protein (casein) contains 680 amino acids. How many codons of the m-RNA code for this protein? Justify.

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 1SQ: A chromosome contains many different genes that are transcribed into different ___ . a. proteins b....

See similar textbooks

Related questions

Q: Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that…

A: The sequence of protein is usually notated as a string of letters, according to the order of the…

Q: One of the codons in mRNA that specifies the amino acid phenylalanine is UUC. What is the anticodon…

A: Answer: Introduction: An anticodon means the three-base arrangement, paired with a specific amino…

Q: Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA…

A: Transcription is process through which DNA is converted into mRNA.

Q: What does “Universality and Degeneracy” of the Genetic Code mean? State the significance of both the…

A: The genetic code is said to be nearly universal. It means that a given codon specifies the same…

Q: Describe the anticodon of a single tRNA that could recognize the codons 5′–AAC–3′ and 5′–AAU–3′.…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the…

A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure which act as genetic material in…

Q: If the genetic code were overlapping, how many complete codons would the followingsequence encode…

A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It…

Q: Order of bases in DNA Order of bases in MRNA (codon) AUC Order of bases in tRNA TAG Amino acid coded…

A: Amino acids are the smallest monomers which are known to form the polypeptide sequence of the…

Q: Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about…

A: Introduction: 20 amino acids make up all the proteins. These are the building blocks of proteins…

Q: if a protein that contain the two codon sequences showed a molar mass of 97,313 g /mol and the UV…

A: The molecular weight of a Protein can be accurately predicted if the amino acids making up the…

Q: Given the following mRNA sequence: 5-AUCCCGUAUGCCCGGGAGCUAGCCCAGC-3 a) Label the first condon, the…

A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…

Q: A segment in the middle of an mRNA has the sequence 5¿- AGAGAACCGCGA-3¿. Using the codon table,…

A: With the help of translation process protein forms. The nucleotide sequence are translated into…

Q: . The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…

A: Arginine is coded by six mRNA codons.

Q: Consider the MRNA sequence below. Assume that the following mRNA segment has been translated.…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: The earliest work on the genetic code established UUU, CCC, and AAA as the codons for Phe, Pro, and…

A: The genetic code can be defined as a set of rules. The information is encoded in the genetic…

Q: The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1:…

A: BASIC INFORMATION TRANSCRIPTION It is responsible for the formation of hnRNA which has the codes…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An R-loop refers to a structure formed by a DNA (deoxyribonucleic acid) and an RNA molecule. As a…

Q: The following segment of DNA in a hypothetical model organism encodes a polypeptide containing SEVEN…

A: Francis Crick proposed central dogma. The RNA is formed from DNA with the help of enzyme RNA…

Q: Consider the following wild-type and mutant sequences:Wild-type ....CTTGCAAGCGAATC....Mutant…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: Ôn the space provided, type the translation product of wild-type gene A (use three- letter…

Q: How many possible nucleotide sequences could code for a peptide with the sequence "MRRTGERS*"? (Note…

A: The given sequence is 'MRRTGERS*'. The amino acid sequence is…

Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA

A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…

Q: What does it mean when we say that the genetic code is degenerate? Discuss the universality of the…

A: The genetic code is a system of triple letter codons that are made up of a combination of the…

Q: When researchers obtain genomic sequence data from organisms with little known genetic information,…

A: The central dogma of life includes the following processes: Replication: In this process, the DNA…

Q: Consider the mRNA sequence below. Assume that the following MRNA segment has been translated.…

A: Genetics is the branch of biology that deals with the study of genes, their variation, and heredity…

Q: Although techniques are available for determining the sequences of amino acids in proteins, it is…

A: It is easier to sequence proteins indirectly by determining the base sequence of the gene for…

Q: The E site may not require codon recognition. Why?

A: The translation is the process, during which protein is synthesized from mRNA sequence. The mRNA…

Q: Using the genetic code, interpret the following set of nucleotides.…

A: The genetic code is a set of rules that living cells use to convert information found in genetic…

Q: What is unusual about the answers for Questions 13k, 13l, 13m, and 13n? Because the multiple codons…

A: Triplets of nucleotides are called codons which specifies individual amino aids in a polypeptide.…

Q: ) Identify the current stage of the translation process shown in Figure 1 and name the anticodon…

A: Translation is a orocess in which mRNA produce protein by the help of ribosome and tRNA.there are…

Q: Suppose that codons consisted of 4 nucleotides instead of 3 and that there were only 2 different…

Q: An mRNA transcript is listed below and contains both start and termination codons. Assume that the…

A: mRNA(messenger RNA) is a type of RNA(ribonucleic acid) that carries complementary sequence…

Q: Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to…

A: Genetic codon It is a group of three nucleotide that code for amino acids. They are total 64…

Q: Describe the effect of this mutation on the amino acid sequence of the beta-gloving polypeptide…

A: Point mutation It refers to the mutation in which the single-nucleotide of the sequence of DNA…

Q: Determine which amino acid is formed from the following mRNA codon: GUA. a aspartic acid b…

A: Introduction :- Amino acids are the building blocks of proteins. The building blocks of life are…

Q: Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code…

A: Note - We answer one question at a time. The set of rules through which information in the DNA or…

Q: A. What amino acid sequence is encoded by the codon sequence AUAAUGGUAACGGUU? B. Suppose the codon…

A: DNA is the carrier of genetic information in almost all organisms except certain RNA viruses such as…

Q: AAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If…

A: Introduction: Mutations are changes in the genetic material or character of an organism. It can…

Q: - Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: mRNA contains coding regions (exons) and non-coding regions (introns). The introns are removed by…

Q: UAG CUA UCA AAU AGA, what tRNA anticodons would be needed to translate the sequence?

A: RNA- It stand for the ribonucleic acid. is a nucleic acid present in all living cells and in some…

Q: Assume that the following mRNA segment has been translated. 5’-UACCGAAUGUCU-3’ Note for…

A: Translation is the process during which codons in mRNA are identified by tRNA with specific…

Q: A mutation that changes a C to a T causes a type of Ehlers-Danlos syndrome, forming a “stop” codon…

A: Ehlers-Danlos syndrome is a most common genetic connective disorder causing the collagen of body to…

Q: The flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation…

A: Virus are mostly pathogenic forms which neither considered to be living or non-living outside the…

Q: Explain the reasoning establishing that a sequence of three nucleotides (a triplet codon) is the…

A: The nucleotide can be defined as the basic building block of nucleic acids. RNA and DNA can be…

Q: The template strand of a double helical segment of DNA consists of the following sequence:…

A: DNA is composed of nucleotides and it is a double-stranded helical molecule, and each of nucleotide…

Q: Which of the following statements are accurate descriptions of the genetic code? MARK ALL THAT APPLY…

A: Transcription is the process in which the mRNA copied information from DNA for protein synthesis.…

Q: Determine the sequence of amino acids specified by the codons in the following information strand.…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: Translation is the process of synthesis of proteins from mRNA. During the process of translation,…

Concept explainers

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.

Question

Milk is secreted by the cells grouped in acini of the mammary glands and then secreted through the
galactophore's channels (document 1). Casein is the main protein found in milk. It is coded by gene of
known sequence of nucleotides in the sheep and cow.
Blood capillary -
Galactophore
channel
Red blood-
Sequence of the non transcribed strand
of the gene coding for casein
GCC СTT GTT СТТ ААС ТТА САА САТ ССА
TTC CTC AAT CTT AAT TTG GGA CAG CCT
corpuscle
Lumen of the
acinus
Sheep
cow
Secretory cell
Doситеnt 1
Document 2
5. Using the genetic code table, find the sequence of amino acids coded by the 2 DNA sequences (document 2).
• Assume that the mature functional protein (casein) contains 680 amino acids.
6. How many codons of the m-RNA code for this protein? Justify.
• In some human females, the milk secreted by their mammary glands doesn't contain casein. The sequences
of a part of the transcribed gene that codes for casein protein in such females and in normal females (their
milk contains casein) are shown in the following document:
Codon Number
Base Sequence of Normal
DNA Transcribed Strand
Base Sequence of Abnormal
DNA Transcribed strand
ТАС ТСС
СТС
AAT
СТ
AAT
TTG
ТАС ТСС
СТС
AAT
CTT
ATT
TTG
7. Compare the 2 DNA sequences and explain the absence of functional casein in abnormal females.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1 Introduction

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

In a cell that produces only one type of protein, which of the following statements about the relationship between hnRNA and mRNA is TRUE? O Heterogeneous nuclear RNA is always larger than mRNA. O Heterogeneous nuclear RNA is always smaller than mRNA. O Heterogeneous nuclear RNA and mRNA are typically the same size. O Heterogeneous nuclear RNA is always the same molecule as mRNA. There is no consistent relationship between the size of the two molecules.
Dystrophin is a protein that forms part of a vital protein complex that connects the cytoskeleton of a muscle fiber cell to the extracellular matrix. This connection strengthens and shapes the muscle fibers. Dystrophin is coded by the DMD gene. This is one of the longest human genes known, covering 2,300,000 base pairs (0.08% of the human genome) It is located in chromosome 21. The immature mRNA is 2,100,000 bases long and takes 16 hours to transcribe. It contains 79 exons. The mature mRNA measures 14,000 and codes for a protein with 3,685 amino acids. Abnormal expression of dystrophin leads to severe symptoms like muscle weakness and fatigability, a disease that is called muscular dystrophy. Most patients with muscular dystrophy become wheelchair dependent early in life. Cardiac muscle is also affected which results typically in premature death (~ second or third decade of life). Several mutations in this gene have led to the production of low levels of dystrophin or of a defective,…
Examine the following sequence of DNA3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG – ACT – AGG-5’Write out the complementary DNA sequence (identify 3’ and 5’ ends)Write out the complementary mRNA sequenceWrite out the peptide sequence this DNA encodes
Geneticists are studying a malfunctioning protein that causes impaired endothelial cell migration and angiogenesis. They have noticed that the amino acid sequence of the protein is truncated compared to normal controls. The mutated mRNA strand is isolated, and analysis shows a nonsense mutation located near the 3' end of the coding region. The 3' terminal coding sequence of the abnormal mRNA strand is shown below. 5`- AUG-ACC-ACU-CCA-CUG-UUG-UUC-CAA-GGG-GAG-AGC-UAG-GUC-CGG-GGC-GGA-AAA-UUU-UAA-3` Write down the tRNA anticodon responsible for adding the last amino acid?
The study of full complement of proteins expressed by a genome is calleda) Proteomeb) Proteomicsc) Genomicsd) Protein formation
which is the following is not a step in the process of de novo gene birth? o translated peptides provide some benefit to the orhganism, leading to selection for increased expression. o the open reading frame picks up sequences that enable recognition of its transcribed mRNA by the ribosome. o an open reading frame is created through mutations. o the gene copy number changes as a result of gene duplication to make paralogs.
A gene with the following DNA sequence is transcribed and translated: 5’ TAGCTACGGAAAGCGTACACGGACT 3’ Briefly explain how the above mentioned DNA sequence will be transcribedto RNA.
. While perusing the E. coli K12 genome sequence,you come across a gene with no known function. Theamino acid sequence of the gene’s protein productshows weak similarities with known porins, proteinsthat cross a cellular membrane to let molecules suchas amino acid or sugar nutrients (or drugs like penicillin) pass through. Some porins are nonspecific and letany solute up to a certain size transit into the cell.Other porins are specific and allow the transit ofcertain sugars but not others. What genetic experiments could you do to try to determine whether thisnew gene has a specific function in allowing bacterialcells to scavenge the sugar maltose from the environment? Describe scenarios that might complicate yourexperimental approach.
Provide an mRNA sequence and the protein for the following DNA sequence 5'TCC GGT CAT'3
GIVEN THE FOLLOWING DNA SEQUENCES (+) OF THE GENBANK: INDICATE WHICH IS THE TEMPLATE MOLECULE, WHICH IS THE mRNA AND THE POLYPEPTIDE THAT IS FORMED FROM THE SEQUENCE DNA 5' atgagtaaagga 3'
RNA are extracted from liver cells and separated in agarose gel by electrophoresis side-by-side with a molecular weight marker. The separated RNA fragments are then transferred to an RNA-binding membrane. Next, this membrane is incubated with labelled probe specific for the gene X. This experiment determines: MOLECULAR BIOLOGY_basic how many copies of gene X there are in liver cells. if the gene X is translated in liver cells. if gene X has a point mutation in liver cells. the chromosomal location of gene X. the length of the transcript of gene X.
Cap, EA1, and Sap are all genes/proteins of interest in this study. For each gene, what gene product is encoded and where is the gene (the literal DNA sequence) located physically in the cell? I need help fimiding this in the artticle and answer as short as possible https://www.ncbi.nlm.nih.gov/pmc/articles/PMC106848/