The tRNA anticodon sequence 3’GAG 5’ is charged with the amino acid leucine. This anticodon may pair with both 5’ CUC 3’ and 5’ CUU 3’. Which of the following is consistent with this phenomenon? 1. The information provided is not accurate since only the 5’ CUC 3’ codon can complementary base pair with the 3’ GAG 5’ anticodon 2. This feature allows for the genetic code to be degenerate 3. This feature allows for the genetic code to be overlapping 4. This feature is commonly associated with tautomeric shifts 5. This feature causes a change in the encoded amino acid

Q: Two missense mutations in the gene that encodes an enzyme called superoxide dismutase cause a form…

A: According to the question, we have to mention the codons which are responsible for the…

Q: Examine the following base sequence – 5’ UGA 3’. It represents the anticodon region of a particular…

A: Answer - This tRNA would carry the amino acid Serine to the ribosome.  mRNA carries codon. tRNA…

Q: A TRNA molecule with the anticodon UGC would be carrying the amino acid: Second base of codon…

A: tRNA brings its amino acid to the mRNA in a specific order. This specific order can be determined by…

Q: The hypothetical mRNA sequence below contains the coding region for a short peptide. What…

A: Mutation generally occurs when the base pair of the DNA gets altered by Mutagens or other chemicals…

Q: Give 3 different tRNA anticodon sequences that could be mutated by a single base substitution into…

A: In transcription, mRNA takes the message from DNA to the cytoplasm for translation into proteins…

Q: CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5

A: Genetic codes are read in the form of triplets.first we will convert them to the triplets and then…

Q: Describe the anticodon of a single tRNA that could recognize the codons 5′–AAC–3′ and 5′–AAU–3′.…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the…

A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure which act as genetic material in…

Q: What are the possible codons that a tRNA molecule could interact with if it is carrying each of the…

A: A codon is a triplet nucleotide of DNA or RNA corresponding during protein synthesis to a particular…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…

Q: . The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…

A: Arginine is coded by six mRNA codons.

Q: describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be…

A: Usually Central dogma of Molecular Biology is followed during the process of protein synthesis which…

Q: Which of the following arms of t-RNA is required for recognition of the t-RNA by its proper…

A:

Q: A mutant E. coli strain is found with a mutation affecting some of its tRNA(Cys). The wild type…

A: The translation is the process of analyzing the mRNA message in order to produce a protein. It is…

Q: Explain why it is that the anticodon sequence AGG can bind to multiple different Serine codons. 2.…

A: The genetic codes are triplet of four bases ATGC and thus 43=64 codons are possible. These 64 codon…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: A ribosome is a biological unit made up of RNA and protein that functions as the cell's protein…

Q: The figure below shows a ribosome in the process of translating an mRNA with the sequence:…

A: Codon refers to a sequence of three nucleotides, which codes for start signal, stop signal for…

Q: Use the numbers below to indicate the correct order of events (from left to right) during the…

A: Hi, Thanks For Your Question.  Answer : Correct Sequence Is 3 4 2 1 5.

Q: The wobble rules for tRNA-mRNA pairing are shown. If we assume that the tRNAs do not containmodified…

A: The pairing of tRNA anticodon with mRNA codon lead from the 5’ end of codon. The first 2 position…

Q: Which of the following would explain the formation of double-stranded loops in tRNA? A.…

A: tRNA stands for transfer RNA. It is responsible for transferring the amino acids from cytoplasm to…

Q: The 5′ region of the TPP riboswitch in Bacillus subtilis is very similar to the TPP riboswitch in E.…

A: Bacterias are genetically regulated by RNA, they use a ribonucleic acid sequence encoded within mRNA…

Q: The figure provided in in the introduction above shows adenine being deaminated to form the…

A: Wobble hypothesis - is about the base pairing between nitrogen bases in 1st and 2nd positions of the…

Q: Imagine that you repeat the tRNA Selection experiment with modifications as follows: 1. Synthesize…

A: tRNA  It is a leaf like structure can has anticodon sequence at one end and attached amino acid on…

Q: In prokaryotic protein synthesis, formylmethionine (fmet) is the first amino acid incorporated,…

A: Methionine which is a central molecule in one-carbon metabolism is an essential amino acid needed…

Q: List all single base substitutions that would change a codon for Leu to a nonsense codon. For each,…

A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: Ribosomes are the protein synthesizing machinery present in a cell. A protein is synthesized during…

Q: With in vitro translation of an RNA into a polypep-tide chain, the translation can begin anywhere…

A: A cell "reads" the information in a messenger RNA (mRNA) during translation and uses it to create a…

Q: When examining the genetic code, it is apparent that ________.     there are 44 stop codons…

A: The process of polypeptide chain synthesis or protein synthesis is known as translation. By this…

Q: Suppose the following peptide chain was attached to a gly -tRNA during translation : met -leu-asp…

A: Serine will be added next to glycine in the growing peptide chain through formation of a peptide…

Q: Vaccina virus (used in the polio vaccine) produces an enzyme that takes the 5’ cap off of the mRNAs…

A: The 5'-G caping is only found in the eukaryotic mRNA. This is the result of post transcriptional…

Q: The charging of a tRNA with an amino acid can be represented by the following equation:amino acid +…

A: Translation is a biochemical phenomena in which mRNA molecule gets translated to proteins. Charging…

Q: Follow the path of codons to discover the peptide and unlock the Directional Multilock. (Hint: type…

A: Peptide formed from given mRNA sequences.

Q: The figure below shows a ribosome in the process of translating an mRNA with a sequence:…

A: Translation is a process in which a single stranded RNA sequence formed at the end of transcription…

Q: The peptide bond formation a. occurs when two tRNAs are located inside the P and A site in the…

A: Given: The peptide bond formation.

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: The amino acids are coded by the group of three bases called base triplets and codons.

Q: Describe how the base pairing between the Shine–Dalgarno sequence and the 30S subunit provides a…

A: The translation represents the process of protein synthesis by which the base sequence of the mRNA…

Q: For the m-RNA  nucleotide codons given below, what is the corresponding sequence of amino acids?…

A: mRNA is also called as messenger molecule which is produced by RNA polymerase. The mRNA is produced…

Q: A series of tRNAs have the following anticodons. give all possible codons with which each tRNA can…

A: Anticodon relatable term with another term which is codon. A codon is a three-nucleotide stretch of…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: A ribosome is a biological unit made up of RNA and protein that functions as the cell's protein…

Q: Label the following regions on this tRNA molecule, stating the function of each:

A: This is a tRNA molecule. It has an amino acid arm where the corresponding amino acids bind. It has…

Q: The flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation…

A: Virus are mostly pathogenic forms which neither considered to be living or non-living outside the…

Q: in a clever experiment performed in 1962, a cysteine already attached to its tRNA was chemically…

A: The tiny RNA molecule transfer RNA (abbreviated tRNA) is essential for protein synthesis. Transfer…

Q: A mutation is found in a tRNA-encoding gene. The wild type allele produces a tRNA that recognizes…

A: The translation is a process by which the proteins are synthesized. Proteins are important for the…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: Central dogma of life involves gene expression, or the flow of genetic information from genes to…

Q: Sickle cell disease is caused by a so-called “point mutation" in the human B-globin gene. A point…

A: Point mutation is the mutation of a single base pair that is the cause of sickle cell anaemia.

Q: Which of the following is NOT a general feature of tRNA? A. All TRNAS contain 4 loops, the anticodon…

A: tRNA is transfer RNA which is an adaptor molecule and assists in formation of peptide chain during…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: The start codon is the first codon of an mRNA (messenger RNA ) transcript translated by a ribosome.…

Q: Determine the sequence of amino acids specified by the codons in the following information strand.…

A:

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.