3 4GUCA template strand of DNA in a gene reads: ATGGCTGGGTGCTTTTAA.Using the codon chart provided, what is the sequence of amino acids thatis produced when this gene is translated? *PheLeu(F)(L)GluSerAspE)(S)(D)GUCAla(A)ACGUU Cys (C)Val(M)G Trp (W)Arg (R)A CLeu(L)ASer (S)CUGALys (K)Pro(P)Asn(N)HisThr(T)Gin (H)(Q)IleArg(R)Start|StopMet-Ala-Gly-Cys-Phe-MetMet-Ala-Gly-Cys-PheMet-Ala-Gly-Cys-Phe-Met-stopAla-Gly-Met-Cys-Phe-none of the aboveMet (M)

The template DNA strand, from which the mRNA is synthesized is as follows, 5' ATGGCTGGGTGCTTTTAA3'…

A template strand of DNA in a gene reads: ATGGCTGGGTGCTTTTAA. Using the codon chart provided, what is the sequence of amino acids that is produced when this gene is translated? * Leu Glu Asp (D) GUC Cys (C) GU Val (M) U Trp (W), Arg (R) G A C Leu (L) Ser (S) A CUGA Lys (K) Pro Asn (N) His The Gin 00 (T) Arg (R) Start Stop Met-Ala-Gly-Cys-Phe-Met Met-Ala-Gly-Cys-Phe Met-Ala-Gly-Cys-Phe-Met-stop Ala-Gly-Met-Cys-Phe- none of the above 13 Met

A template strand of DNA in a gene reads: ATGGCTGGGTGCTTTTAA. Using the codon chart provided, what is the sequence of amino acids that is produced when this gene is translated? * Leu Glu Asp (D) GUC Cys (C) GU Val (M) U Trp (W), Arg (R) G A C Leu (L) Ser (S) A CUGA Lys (K) Pro Asn (N) His The Gin 00 (T) Arg (R) Start Stop Met-Ala-Gly-Cys-Phe-Met Met-Ala-Gly-Cys-Phe Met-Ala-Gly-Cys-Phe-Met-stop Ala-Gly-Met-Cys-Phe- none of the above 13 Met

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

A. What amino acid sequence is encoded by the codon sequence AUAAUGGUAACGGUU? B. Suppose the codon sequence AGACACUCUAUUAAA has a single base pair mutation to AGACACUCUUUUAAA. If the old protein sequence was Arg-His-Ser-Ile-Lys, what will be the new sequence encoded by the mutant gene?
Suppose the codon sequence GCCAUUCAAGCGGAU has a single base pair mutation to GCCAUUCAAACgGAU. If the old protein sequence was Ala-Ile-Gln-Ala-Asp, what will be the new sequence encoded by the mutant gene? _________(Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Le
A scientist sequencing itiRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this itiRNA makes when it is translated?
If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?
5' ACTGAGGATTCGGACAGCAATAGGATG 3' When translated, the -1 reading frame of the sequence above gives the following amino acid sequence: HPIAVRILS What triplet of nucleotides (in other words, what DNA codon) represents the amino acid "P" (proline)? a) 5' GTA 3' b) 5' CAT 3' c) 5' CCT 3' d) 5' ATC 3'
1. Here is the amino acid sequence of part of a hypotheticalgene you want to clone:Pro-Arg-Tyr-Met-Cys-Trp-Ile-Leu-Met-Ser a. What sequence of five amino acids would give a 14-merprobe with the least degeneracy for probing a library tofind your gene of interest? Notice that you do not use thelast base in the fifth codon because of its degeneracy. b. How many different 14-mers would you have to makein order to be sure that your probe matches thecorresponding sequence in your cloned gene perfectly? c. If you started your probe one amino acid to the left of theone you chose in (a), how many different 14-mers would youhave to make? Use the genetic code to determine degeneracy.
1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.
Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?
1.) if the B chain of human hemoglobin is 146 amino acids in length, calculate the minimum # of nucleotide base pairs needed to code for B-globin? 1a.) How many mRNA codons does this correspond to?
1. Here is the amino acid sequence of part of a hypotheticalgene you want to clone:Pro-Arg-Tyr-Met-Cys-Trp-Ile-Leu-Met-Sera. What sequence of fi ve amino acids would give a 14-merprobe with the least degeneracy for probing a library tofi nd your gene of interest? Notice that you do not use thelast base in the fi fth codon because of its degeneracy.b. How many different 14-mers would you have to makein order to be sure that your probe matches thecorresponding sequence in your cloned gene perfectly?c. If you started your probe one amino acid to the left of theone you chose in (a), how many different 14-mers would youhave to make? Use the genetic code to determine degeneracy.
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
5’ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’ 3’TAGCGCGATCCGCGTACGATGGATCCGATAGACGGATCGATAGCTGATTAGACTAGCTCAGTC5’ Write out the pre-mRNA for this geneWrite out the mRNA for this geneHow many amino acids does this protein have? Translate the protein Label your 5’ and 3’ UTR’s