100 50 10 1 10 10 Cot DNA renaturation curves occasionally show three distinct phases of rena- turation. In this graph, DNA renaturation is plotted against "Cf" (initial concentration times time of renaturation-essentially a measure of relative renaturation time). See Figure 21.4. (a) Identify each part of this plot that corresponds to reannealing of (1) unique sequences, (2) moderately repetitive sequences, and (3) highly repetitive sequences. (b) Suppose that you cloned a single-copy gene, such as the gene for dihy- drofolate reductase (DHFR), into a plasmid vector and subjected it to renaturation analysis. Sketch the curve you might expect. (c) Suppose that you used reverse transcriptase (Chapter 24) to copy the ovalbumin mRNA and cloned this complementary DNA (CDNA) into a plasmid vector. Would you expect this CDNA to reanneal (1) more slowly. (2) more rapidly, or (3) at the same rate as genomic DNA? Briefly explain your answer. % Single stranded

100 50 10 1 10 10 Cot DNA renaturation curves occasionally show three distinct phases of rena- turation. In this graph, DNA renaturation is plotted against "Cf" (initial concentration times time of renaturation-essentially a measure of relative renaturation time). See Figure 21.4. (a) Identify each part of this plot that corresponds to reannealing of (1) unique sequences, (2) moderately repetitive sequences, and (3) highly repetitive sequences. (b) Suppose that you cloned a single-copy gene, such as the gene for dihy- drofolate reductase (DHFR), into a plasmid vector and subjected it to renaturation analysis. Sketch the curve you might expect. (c) Suppose that you used reverse transcriptase (Chapter 24) to copy the ovalbumin mRNA and cloned this complementary DNA (CDNA) into a plasmid vector. Would you expect this CDNA to reanneal (1) more slowly. (2) more rapidly, or (3) at the same rate as genomic DNA? Briefly explain your answer. % Single stranded

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 10P: Homologous Recombination, Heteroduplex DNA, and Mismatch Repair Homologous recombination in E. coli...

See similar textbooks

Similar questions

2b) If you denatured the random 1000 bp fragments of potoroo DNA by heating them to 95°C. and then cooled them down to 60°C and allowed them to reanneal, you would find that approximately 20% of the DNA fragments renatured very rapidly, another 30% of the DNAfragments renatured moderately rapidly, and the remaining DNA fragments renatured relatively slowly. From these results, whatfraction of the potoroo genome is composed of highly repetitiveDNA? helpful Information
DNA renaturation curves occasionally show three distinct phases of renaturation. In this graph, DNA renaturation is plotted against C0t (initialconcentration times time of renaturation—essentially a measure of relativerenaturation time). See Figure 21.3.(a) Identify each part of this plot that corresponds to reannealing of (1)unique sequences, (2) moderately repetitive sequences, and (3) highlyrepetitive sequences.(b) Suppose that you cloned a single-copy gene, such as the gene for dihydrofolate reductase (DHFR), into a plasmid vector and subjected it torenaturation analysis. Sketch the curve you might expect.(c) Suppose that you used reverse transcriptase to copy the ovalbumin mRNA and cloned this complementary DNA (cDNA) into a plasmid vector. Would you expect this cDNA to reanneal (1) more slowly, (2) more rapidly, or (3) at the same rate as genomic DNA? Briefly explain your answer.
If the bandicoot genome is 3.62 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'TGCGTGTGTGC3' and its complement, how many copies of this sequence are present in the bandicoot genome?
Homologous Recombination, Heteroduplex DNA, and Mismatch Repair Homologous recombination in E. coli leads to the formation of regions of heteroduplex DNA. By definition, such regions contain mismatched bases. Why doesnâ€™t the mismatch repair system of E. coli eliminate these mismatches?
What is the role of di-deoxy DNTPs in a Sanger sequencing reaction? Please select the answer that is most correct. The di-deoxy DNTPs are incorporated into the growing DNA molecule. The di-deoxy DNTPs terminate polymerisation of the growing DNA molecule, thereby creating fragments which all end in that specific di-deoxy base. Subsequent separation of the fragments by size facilitates the ascertainment of the sequence. The di-deoxy DNTPs facilitate polymerisation of the growing DNA molecule. this allows for multiple copies fo the template to be made for further analysis. The di-deoxy DNTPs terminate polymerisation of the growing DNA molecule. Ending the replication ensures that the molecules are not too long to be sequenced.
(a) What two enthalpic factors stabilize DNA in double-helical form at lowtemperature?(b) What entropic factor destabilizes helical DNA at high temperature?(c) Why is the double-helical structure of DNA stabilized at moderate tohigh ionic strength?
Let’s say that a stretch of repeated AT issuccessfully sequenced. From what you know of the difficulties ofsequencing long repeated sequences, what other problems mightyou encounter in assembling these fragments?
consider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. if the given DNA sample was subjected to ion-torrent sequencing, sketch the expected profile of the sequencing output. assume that the sequential flooding of nucleotides follows the order G-C-A-T.
Why are the first 20 bases typically ignored from a Sanger sequencing .ab1 file?
Even in automated sequencing, where you can include all 4 ddNTPs in one reaction, you need to include "normal" dNTPs as well as the ddNTPs - why are these necessary? Why can't you just put in the ddNTPs, since you've got all four of them available to the DNA polymerase?
Compare the structural features that distinguish B-DNA from A-DNA and Z-DNA. What is known about the functional properties of these variants of B-DNA, the Watson–Crick structure?
The chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC. 2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?