In the actual experiment, the researchers used 149 sequences to buildtheir sequence logo, which is shown below. There is a stack at eachposition, even if short, because the sequence logo includes moredata. (a) Which three positions in this sequence logo have the mostpredictable bases? Name the most frequent base at each. (b) Whichfour positions have the least predictable bases? How can you tell?

In the actual experiment, the researchers used 149 sequences to buildtheir sequence logo, which is shown below. There is a stack at eachposition, even if short, because the sequence logo includes moredata. (a) Which three positions in this sequence logo have the mostpredictable bases? Name the most frequent base at each. (b) Whichfour positions have the least predictable bases? How can you tell?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

In reversible terminator sequencing, how would the sequencing process be affected if the 3′-end-blocking group of each nucleotide were replaced with the 3′-H present in the dideoxynucleotides used in Sanger sequencing?
if i had 3 sequences that were 15 nucleotides long. how would i make an optimal sequence alignment using gaps?
If the bandicoot genome is 3.62 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'TGCGTGTGTGC3' and its complement, how many copies of this sequence are present in the bandicoot genome?
If you have access to the necessary computer software, make asequence file and analyze it in the following ways: What is thetranslated sequence in all three reading frames? What is the longest open reading frame? Is the sequence homologous to any known sequences? If so, does this provide any clues about the function of the sequence?
Design a pair of primers (22 nucleotides long each) for the following sequence to clone the full sequence atggaatataactctagtccacattccggtgcattttttccaatcgggtcagactcaggatccaaatctccttgtggcagcgtgaacgtcgtctcctctgatggagatggttcaggtgggaatgggagtga
You were going to sequence a rice DNA fragment whose sequence was only know at one end, as shown below. 5’ AAACGATCGAGTCGCATCCAAAATCGATACCC—unknown region 3’ TTTGCTAGCTCTGCGTAGGTTTTAGCTATGGG—unknown region After several tries, you obtained a beautiful sequencing image as shown here: The worked out well partially because you had designed a primer for sequencing the unknown region according to the following guideline: Tm is 55 – 60°C. Ensures primer had a appropriate melting temperature for PCR ans sequencing. The GC content of the primer is the same as the genome/template (rice = 60%, human/Drosophila = 45-50%). A same nucleotide cannot be more than 2 in a row, e.g. CCC, GGGGG, AAA. The secondary structure of the primer must be none or weak. No primer dimers (The primer anneals to itself). 3’ end is the most important: it should not end in A, preferably ends in GG, GC, CG or CC This website can help you design the primer: http://www.oligoevaluator.com/OligoCalcServlet…
Hơ many mismatches would you expect to find between this sequence and the reference sequence? I know the answer is 3, can you please explain why?
Let’s say that a stretch of repeated AT issuccessfully sequenced. From what you know of the difficulties ofsequencing long repeated sequences, what other problems mightyou encounter in assembling these fragments?
Let’s assume the linker region of DNA averages 54 bp in length. How many molecules of H2A would you expect to find in a DNA sample that is 46,000 bp in length?
why is gap opening penalized more than gap extension in doing alignment of sequence similarity?
Which of the following (A through E ) would you expect to find in a nucleotide chain constructed for Sanger sequencing?
Using the Dynamic Programming algorithm for pairwise local alignment we covered in class, construct the dynamic programming score table for a local alignment of the following two sequences, using the following scoring parameters: match score = +5, mismatch score = -3, gap penalty = -2.: ACGTATCGCGTATA GATGCTCTCGGAAAWhat is score of the best local alignment between these two sequences? Show the alignment of these sequences. asap