a. Ribose-5-phosphate is produced by oxidative decarboxylation of 6-phosphogluconate catalyzed by the enzyme glucose-6-phosphate dehydrogenase. I. True II. False b. The pentose phosphate pathway occurs in the mitochondrion of tissues actively engaged in synthesis of fatty acids. I. True II. False

a. Ribose-5-phosphate is produced by oxidative decarboxylation of 6-phosphogluconate catalyzed by the enzyme glucose-6-phosphate dehydrogenase. I. True II. False b. The pentose phosphate pathway occurs in the mitochondrion of tissues actively engaged in synthesis of fatty acids. I. True II. False

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter27: Metabolic Integration And Organ Specialization

Section: Chapter Questions

Problem 11P

See similar textbooks

Related questions

Q: Explain the meaning behind the term "reducing sugar ".

A: Any sugar that acts as a reducing agent due to the presence of its free aldehyde or ketone…

Q: How consuming too much dietary fat and drinking carbonated drinks affects lipid metabolism

A: Dietary fat and carbonated drink consumption have been found to be associated with several different…

Q: Using the Pearson square technique, determine the amount (lb) of skim milk (assume 0.0% milkfat)…

A: Skimmed milk contains no cream or less fat than regular milk. Typically, it contains just 0.1% fat…

Q: An unknown amino acid labeled BAYOKEM has an IpH value equal to 5.97. 1. If its pka2 is equal to…

A: pH is the measure of the strength of H+ ion or Hydronium ions in solution. pOH is the…

Q: What is the maximum number of possible intra-peptide disulfide bonds for any given peptide form?

A: The side chains of Cysteine residues in proteins undergo oxidation to form disulfide linkages.

Q: You need to prepare an acetate buffer of pH 5.43 from a 0.621 M acetic acid solution and a 2.95 M…

A: At equilibrium 0.40875 - x moles of acid x moles of its conjugate base. Initial moles of CH3COOH…

Q: The TATA box and Initiator element (Inr) is recognized by which protein complex? How tight is this…

A: The sequence TATA can be found in most promoters. This sequence binds RNA polymerase. The TATA box…

Q: 5'- What will be the Sanger products of the DNA with base sequence ACGTCGACTCCGGTC-3'

A: DNA sequencing is the biochemical method used for determining the order of nucleotide bases, A, G,…

Q: Q1. Many of the components for lipid synthesis need to be "activated", which happens by a variety of…

A: Lipids are non-polar biomolecules, which act as the major components of the plasma membrane, energy…

Q: ACTIVITY 8.2 Draw the different spontaneously formed lipid structures: a. Monolayers and bilayers b.…

A: The lipids are capable of organization into different types of structures in an aqueous environment…

Q: Discuss how adsorption, covalent binding, entrapment and encapsulation are used to immobilize…

A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…

Q: Oxidative phosphorylation generates ATP using the reducing power of [NADH, FADH2 or malate] to move…

A: In the electron transport chain there are three large multiprotein complexes that can serve as…

Q: Is it true that coconut oils contain no cholesterol? Provide reasons

A: Coconut oil is basically a tropical oil derived from the dried nuts of coconut palm tree.

Q: Base your answers on the choices below: Specific Analyte for Test Mechanism of Test Positive Result…

A: The qualitative tests are used to detect the presence or absence of a substance. Different…

Q: The pentose phosphate pathway is a critical pathway in animals for the production of NADPH and…

A: Cells are machinery structures which carry out various complex controlled biochemical reactions in…

Q: Which of the following is true regarding folate/folic acid: a.Intakes below recommended dietary…

A: Folic acid is B family Vitamin which aids in the formation of healthy new cells in the body. Folic…

Q: SARS-CoV (P SARS-CoV-2 ( 48 h G 1201 Cell- Cell- 100 I Percentage (%) 80 60- 40- 20- SARS-CoV (PV)…

A: Gluc activity was used as a waveform to evaluate the cell-to-cell and cell-free infectious disease…

Q: What would be the final primer concentration if 0.5 ul of 10 uM primers were ad a PCR reaction with…

A: Introduction: A primer is a short strand of DNA or RNA that is usually about 18-22 bases and serves…

Q: A plant isolate was subjected to qualitative tests to determine the presence of macromolecules.…

A: Qualitative tests detect the presence of specific molecules in a sample solution. There are…

Q: What does NOT describe a starch?

A: Starch is a polysaccharide that is produced by most of green plants for the purpose of storage of…

Q: 3. Give the specific enzyme class and first two digits of the enzyme's EC number for each…

A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…

Q: Calculate the energy produced (in ATP molecules) achieved by complete oxidation of the hydrolysis…

A: Carbohydrates are the primary energy source for most organisms. Carbohydrates are digested to…

Q: Shown in the figure, is a portion of the electron transport chain pathway, in which electrons are…

A: The electron transport chain is the transfer of electrons through a series of electrons carriers to…

Q: Which of the following monosaccharide phosphates is NOT produced in the pentose phosphate pathway?…

A: pentose phosphate pathway is a metabolic pathway of hexose oxidation where glucose-6-phosphate is…

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…

A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…

Q: Describe in detail the four levels of protein structure

A: Folding of protein is necessary for its biological activity. Protein folding occurs spontaneously,…

Q: For questions #23 - #27 A solution is made by dissolving 6.26g NAOH in 25.2g water. 19. What is the…

A: The number of moles of any compound is found by making use of formula: number of moles=given…

Q: What is the primary outcome of the malate-aspartate shuttle run during glycolysis

A: An electron shuttle that transports electrons generated under glycolytic conditions into the…

Q: Which vitamin can be produced by the body? O A OD O E

A: Vitamins are not synthesized in the body. Some bacteria in the gut can produce some of the vitamins…

Q: The phosphorylation of proteins is an important regulatory mechanism. a. Name three amino acids…

A: Phosphorylation of amino acids in protein is an important post-translational modification for…

Q: For an enzymatic reaction, the following data were obtained for two different initial enzyme…

A: Enzymes are protein molecules that increase the rate of reactions by decreasing the activation…

Q: A DNA codon has the sequence GAT. What is the resulting tRNA anti-codon in the translation process…

A: Codon is a sequence of three nucleotides present in DNA or mRNA (messenger RNA) molecule that…

Q: On a per-carbon basis, where does the largest amount of biologically available energy in…

A: There are two major types of dietary lipids: plant-derived triacylglycerol and animal-derived…

Q: Scenario IV. Electron Transport Chain Total Number of ATP Obtained from one Pyruvate Molecule Number…

A: Glucose or carbohydrates or sugars are oxidized through the process of glycolysis. Glycolysis occurs…

Q: What are the main functional groups present in carbohydrates? Illustrate and explain.

Q: Given a mixture of three proteins, A, B and C, with isoelectric points pIA = 4.2, pIB = 7.0 and pIC…

A: The isoelectric point (pI) of a protein is defined as the pH at which the net charge of a protein…

Q: Do people need to feel socially and economically superior to others?

A: In the different nations, people have treated inequality, depending on their caste, economic levels…

Q: Discuss the four main mechanisms of antibiotic resistance and factors that promote the emergence of…

A: Antibiotic resistance occurs when microorganisms like bacteria and fungi develop the ability to…

Q: Problem 2. Competitive inhibitors are commonly used to make pharmaceuticals. Some cancer drugs act…

A: We need to plot the Lineweaver Burk Plot (LB Plot) to solve this problem. So first we need to find…

Q: Discuss the uses of alpha-amylase, amyloglucosidase, debranching enzymes , proteases, beta-glucanase…

A: Enzymes are proteins made up of thousand different amino acid chains , catalyzes different…

Q: Which of the following statements regarding enzymes and transition states is true? stabilization of…

A: Introduction: Catalysis is an important function of an enzyme. For any chemical reaction to occur,…

Q: In the regulation of glycogen phosphorylase, which of the following statements is true? The inactive…

A: Gluycogen phosphorylase is an allosteric Enzyme that catalyses the breakdown of glycogen into…

Q: 2. Use your knowledge of amino acids (and the R groups) and tertiary structures of proteins to…

A: Sickle cell anemia is a inherited disorders due to defect in the gene. In this disease mutation…

Q: An alpha-helical structure within a protein is stabilized mostly by O hydrophobic interactions. O…

A: The primary structure of the protein consists of a linear chain of amino acids linked by the peptide…

Q: first half of the Q cycle results in

A: The mechanism of Q-cycle is proposed by Peter Mitchell. Q-cycle terms as proton motive Q cycle. It…

Q: The two main goals of the citric acid cycle are: (a) citrate synthesis and gluconeogenesis…

A: The citric acid cycle was discovered by H. A. Kreb. The reactions of the citric acid cycle occur in…

Q: Failure of anti-oxidant function results in the hydroxylation of an aromatic acid of Enzyme Z and…

A: It isn't mentioned in the question on which strand of the c-DNA was taken for Sanger sequencing. So…

Q: 4. You are to choose the members of an expedition that will climb several high mour Each applicant…

A: Hemoglobin abnormalities are referred to as the type of blood disorders that have a major impact on…

Q: Which compound is NOT a membrane lipid? a). Sphingolipid b). Glycerophospholipid c).…

A: A plasma membrane is composed of a lipid bilayer that allows the diffusion of non-polar molecules…

Q: ACTIVITY 6.1 Complete the table below Source Example of Carbohydrate Function

A: Carbohydrates are a form of macronutrient that can be found in a variety of foods and drinks.…

Question

Long explanations are not needed. Direct answers would suffice.

a. Ribose-5-phosphate is produced by oxidative decarboxylation of 6-phosphogluconate catalyzed by the enzyme glucose-6-phosphate dehydrogenase.

I. True

II. False

b. The pentose phosphate pathway occurs in the mitochondrion of tissues actively engaged in synthesis of fatty

acids.

I. True

II. False

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

A patient exhibiting all the symptoms of beriberi is placed on a thiamine-enriched diet; however, the symptoms do not disappear. Genetic screening suggests a defect in pyruvate dehydrogenase phosphatase. Briefly explain why the genetic defect caused beriberi symptoms andy why thiamine supplementation had no effect.
True or false? Under anaerobic conditions, the pyruvate dehydrogenase complex is responsible for the irreversible conversion of pyruvate to acetyl CoA.
Long explanations are not needed. Direct answers would suffice. a. Transketolases catalyze two-carbon fragment transfer from sedoheptulose-7-phosphate to xylose-5-phosphate. i. True ii. False b. High concentration of NADPH increases the rate of the pentose phosphate pathway by stimulating glucose-6-phosphate dehydrogenase. i. True ii. False
Glucagon secretion inhibits intracellular acetyl-CoA carboxylase activity through a number of different methods. Make a list of everything that comes to mind.
True or false? The E2 component of the Pyruvate Dehydrogenase complex binds NAD+ in its active site.
Glucagon secretion causes inhibition of intracellular acetyl-CoA carboxylase activity by several mechanisms. Name all you can think of.
By looking into the triacylglycerides synthesis pathway, suggest a possible treatment for fat loss/weight reduction. Discuss any possible complications that might occur from using your treatment.
In fatty acid biosynthesis explain the following two parts -(a) What effect will an increase in oxaloacetate in mitochondria have on fatty acid biosynthesis?(b) How insulin and glucagon affect fatty acid oxidation and biosynthesis reactions/pathways, name them.
Compare and contrast glycogen synthesis/degradation in muscles as compared with the liver.
1. State if true or false a. Gluconeogenesis is the exact opposite of the glycolytic pathway b. The end-product of glycolysis is Acetyl CoA c. There is no enzyme being secreted in the stomach for carbohydrate digestion d.Glycerol 3-phosphate shuttle, which is active in skeletal muscles and in the brain, bypasses Complex I and II of ETC resulting to less energy produced compared to malate-aspartate shuttle. e. Insoluble NSP has high water holding capacity and will increase the intestinal transit time of digesta.
Discuss the glycogen degradation. Give the three enzymes required for this process and their functions.
True or False e. Triacylglycerols and glycerophospholipids both contain fatty acids and saponifiable. True False f. Pyruvate serves as the precursor of the glycerol backbone during TAG biosynthesis. True False