Q: 5. Below is an image of DNA sequenced using the Sanger sequencing method, where different…
A: Gel electrophoresis is a molecular technique that aims to separate the DNA, RNA, and protein…
Q: To explain: In terms of natural selection the reason why no new puriri trees in New Zealand are…
A: The Keruru birds are native pigeons found throughout New Zealand. Many trees rely solely on these…
Q: Describe the timeline of an acute infection, particularly naming which cells are the first to arrive…
A: Acute infections are infections that are caused suddenly by any condition or by pathogens such as…
Q: Describe how thermodynamics and metabolism are related.
A: According to first law of thermodynamics energy can neither be created nor destroyed. Though it can…
Q: A previously healthy female patient presents with fatigue and insomnia. An examination shows she is…
A: The above clinical presentation is a typical of a provisional diagnosis of Iron deficiency anemia.…
Q: An allosteric activator or inhibitor
A: The allosteric enzymes functions through reversible, noncovalent binding of regulatory compounds…
Q: List and explain pre-analytical errors that can occur with a specimen and how these errors can…
A: Pre-analytical stages occur during patient preparation, sample collection, sample transportation,…
Q: Why do some biologists think that the apicomplexans descended from dinoflagellates?
A: The finding of a nonphotosynthetic plastid in malaria and other apicomplexan pathogens has prompted…
Q: Explain, in detail, how tyrosine kinase proteins are involved in one signal transduction pathway of…
A: The signal transduction pathways in cell occurs via three types - G protein couple receptors,…
Q: The following sequence of DNA is part of the normal, wild-type gene. 5'TAC CGG GAC TTG AGC CGA…
A: A single nucleotide from the DNA is deleted in nucleotide deletion. Although the single nucleotide…
Q: Below is a Figure of a Shoot Tip, determine which of the encircled part islare meristematic cells? 4…
A: Meristematic cells These cells are undifferentiated. They have the capability of totipotency. They…
Q: Identify a passive tissue that could be exposed to continued plastic stress (deformation). Explain…
A: Passive tissue is those that undergo stretching when they are not even stimulated and hence…
Q: To explain: Why do seedlings that germinate in a fully darkened room grow taller than seedlings of…
A: Every living thing is hardwired to thrive in its own environment. Nonetheless, they require a number…
Q: What is the name of the mechanism that ensures that there is a higher concen- tration of sodium ions…
A: Introduction - Because the phospholipid bilayer is impermeable to charged atoms, ion channels…
Q: uestion 23 Which of the following statements most accurately describes the transport of zebra mus-…
A: Introduction - Zebra mussels have a striped, D-shaped shell made up of two hinged valves connected…
Q: 12. The CFTR gene, on hu chloride ion concentrat cystic fibrosis. How ma In G1 of the cell cycle In…
A: Phase Number of gene/chromosomes G1 phase of cell cycle- 2 copy G2 phase of cell cycle…
Q: Not yet answered Protein X and Y are mixed together. Protein X is 400 residues in size, and…
A: Chromatography It is a laboratory technique through which a mixture is separated into its…
Q: What is an introduction to immunology and immunopathology?
A: The immune system is comprised of various cellular and humoral elements such as T, B-lymphocytes,…
Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…
A: mRNA is made from DNA by the process of Transcription.
Q: What anatomical evidence has been used to support the idea that australopithecines spent time in the…
A: Evolution of human :-
Q: Answer ALL parts of this question. In terms of heart failure there is a decrease in cardiac output.…
A: Introduction - The heart is a little organ that circulates blood throughout your body. It is your…
Q: Blue feather color is dominant to brown feather color. Which of the following statements is true…
A: Dominant and Recessive alleles Dominant alleles are those that mask the expression of other alleles…
Q: QUESTION 28 The flies in the figure are mated. Which chromosomes would have the highest frequency in…
A: A breeding experiment among two animals that are exactly hybrid for two features is referred to as a…
Q: Which are considered Zoonotic diseases? Select all that apply. O Ebola O HIV O Rabies Hantavirus…
A: Disease is a kind of harmful condition which disturb or impairs functioning of body part or whole…
Q: C. leukocidin 4. Today approximately 90% of S. aureus strains are resistant to A. methicillin. B.…
A: 4. When bacteria are first exposed to an antibiotic, those which are most susceptible to the…
Q: of Traits and Species Rhesus Snapping Kangaroo Lamprey Bullfrog Human Tuna Monkey Turtle Dorsal…
A: Cladogram A cladogram is the phylogenetic tree representation that depicts the evolutionary…
Q: Determine the risks and ethical issues associated with nanotechnology
A: Nanotechnology- The term given to those areas of science and engineering where phenomena that take…
Q: sabuoraud slope culture contains a black mould. describe a diagnostic method you can use to identify…
A: Answer :: The Donas do Sabor Festival, a delightful tour of Salvador's kitchens run by women, has…
Q: QUESTION 4 Select all the statements that correctly describe triglycerides. Sources: textbook…
A: Answer
Q: (a) Distinguish between micelles, liposomes, bilayers, vesicles, and membranes. (b) Discuss the role…
A: Ans a- Liposomes are composed of a lipid bilayer separating an aqueous internal compartment from the…
Q: Key properties of proteins include: O a. A wide range of functional groups and an ability to possess…
A: Proteins are large biomolecules and macromolecules that comprise one or more long chains of amino…
Q: Which of the following applies to quaternary structure? O a. It has two alpha and two beta subunits…
A: Introduction The three-dimensional arrangement of atoms in an amino acid-chain molecule is known as…
Q: 17. Lariat formation is a step in which of the following: transcription post-translation…
A: Lariat formation is a step in transcription.
Q: Which one of the following is ordinarily not an air pollutant ? (A) CO2 (B) CO (C) SO2 (D)…
A: Air pollution is the contamination of air due to the presence of chemical, physical and biological…
Q: 15. Why is PK > PNa and by about how much?
A: A characteristic pattern of the rapid rise and subsequent drop in voltage or membrane potential…
Q: To determine: The reason for plant death if its stomata is closed or opened all the time.
A: Introduction Plant cell death is the end of a plant cell's life activities due to an intracellular…
Q: Summarize the basic features of excavates and distinguish among diplomonads, parabasilids, and…
A: Protists are unicellular eukaryotic organisms.
Q: he ability to multiplex the PCR reactions used in STR analysis (many PCR amplifications occurring in…
A: Dr.Kary Mullis invented the polymerase chain reaction (PCR) in 1983. The enzyme used in this…
Q: Are all foods created equal in terms of their effect on the environment? Explain
A: The authors believe that foods that are thought to be harmful to your health, such as red meat, are…
Q: Categorize the fruit cantaloupe (Cucumis melo).
A: The ovary is fertilised in order to produce fruits with one or more seeds. The fruits' primary…
Q: Template strand/Sense strand Coding strand/Antisense strand Region of DNA unwinding Region of DNA…
A: The sense strand, or template strand, is the only strand that is effectively employed as a template…
Q: 14. Why is titin important with respect to muscle contraction?
A: Titin is a striated muscle protein that is abundant. Titin's main duties are to stabilise the thick…
Q: Below is a Figure of a Leaf Epidermis, Determine what is structure X? A.Stomata B. Stomatal…
A: Stomata are small pores present in the epidermis of leaves. They regulate the process of…
Q: A black guinea pig is mated to a white guinea pig, and they produce 12 black offspring. Then, the…
A: A trait is a characteristic features that is unique to particular individual . As per the data :-…
Q: Which of these statements about taste is true? All bitter-tasting compounds have a similar chemical…
A: Taste buds are peripheral organs of gustation that are primarily found in the tongue epithelium but…
Q: What would be the consequences for eukaryotes if all prokaryotessuddenly became extinct?
A: Prokaryotes play an important and indispensable role in our ecology and hence sudden disappearance…
Q: Select the option that is a scientific hypothesis and is testable and false able?(Choose all that…
A: As per our company guideline we are supposed to answer only first question. Kindly repost other…
Q: Part C Suppose that you discover cels containing a mutation in a second protein and learn that this…
A: The ability to degrade proteins is an essential function of all eukaryotic cells. The two main…
Q: Which one of the following organelles is considered as the "energy producing" centre of the cell? A.…
A: Introduction - Cellular respiration is a series of metabolic reactions and activities that occur in…
Q: Q4
A: The physiological lack which the sperm fulfills for an ovum is the lack of spindle set for…
Step by step
Solved in 2 steps
- The body loses water by way of the ________. a. skin b. lungs c. digestive system d. urinary system e. both c and d f. a through dDescribe the control of blood carbonic acid levelsthrough the respiratory system.The carbonic acid equilibrium is shown below. Exhalation of CO2 by the lungs causes this equilibrium to shift to the ______, which causes the pH of the blood to _______. H+ + HCO3- <=> H2CO3 <=> H2O + CO2 a) left; increase b) left; decrease c) right; decrease d) right; increase
- The wastes excreted from the lungs are:A carbon dioxide and excess oxygenB carbon dioxide and nitrogenC water and carbon dioxideIn compensating for metabolic acidosis, the body will slow down the rate of conversion of ammonia to urea excrete more bicarbonate ions increase the respiratory rate decrease the respiratory rateWhich statement is correct about the body's compensation mechanism for metabolic acidosis? A The client will breathe faster to reduce pH. B The client will breathe slower to reduce pH. C The client will breathe faster to increase pH. D The client will breathe slower to increase pH.
- Kidneys control blood pH by excretinga. HCO3b. H+. c. NH3.. d. CO2.A patient is hyperventilating, and suddenlyfeels ill. Which of the following are ways thebody will attempt to maintain homeostasis? (check all that apply) A. Activity will increase at thepneumotaxic center to increase the rateof breathing. B. The person will vomit to removeexcess acid in their system. C. The peripheral chemoreceptors willdetect the level of oxyhemoglobinpresent in the blood .D. The kidneys will secrete more bicarbonate ionsIf acidity of the blood is well below a pH of 7 what is secreted in the urine? A. H20 B. H2CO3 C. H+ D. HCO3
- Discuss the importance of the CO2/HCO3 - equilibrium in blood and in urineWhich reaction is catalyzed by carbonic anhydrase?a. HPO42-+H+ ↔ H2PO4-b. CO2 + H2O ↔ H2CO3c. H2PO4 − +OH− ↔ HPO4 2 − +H2OTwo of the key carbonic anhydrases are in the muscles and in the lungs. What would you expect the major difference would be between these carbonic anhydrases?
