Question 9 doesn't add deoxyribonucleotides to the 3 end of promer. Hence,suncion properly. The bir pay compQ9. Recall that DNA and RNA strands are always read in the 3'5' direction but that DNAand RNA sequences are always synthesized in the 5' 3' direction. Consider the followingDNA sequence:LGGUAVAVAVACAAUQUC UU5'CCATATATATGTTACAGAAAGCGCTGGCTGTTTGACTGACT3'3' GGTATATATACAATGTCTTTCGCGACCGACAAACTGACTGA5'CCAUAVAVAUGUUACAGAA AG CUGGCUGUVUGACUGACUACUGAons2=UAAAUG a) Paying attention to where transcription starts (after the promoter), identify (circle)the bases in the bottom strand that will code for start and stop codons. Write themRNA sequence that would be transcribed if the top strand served as thetemplate.*5.b) Write the amino acid sequence that would be translated from the mRNAsequence you just wrote.8will og PNA is not produced in the process of replication. Thewill lead to stop thereplication process. In absence 156 | Pagof replication, the cell will not divids further.

introduction Messenger RNA is a single-stranded RNA that is responsible for the synthesis of…

add deoxyz мохуч Q9. Recall that DNA an and RNA sequences are DNA sequence: GGUAVAVAVA 5' CCATATATATO 3' GGTATATATAC CCAVAVAVAUC AUG AUG a) Paying attentic the bases in th mRNA sequen template. b) Write the aminc sequence you j is wreeagte. of replication, the

add deoxyz мохуч Q9. Recall that DNA an and RNA sequences are DNA sequence: GGUAVAVAVA 5' CCATATATATO 3' GGTATATATAC CCAVAVAVAUC AUG AUG a) Paying attentic the bases in th mRNA sequen template. b) Write the aminc sequence you j is wreeagte. of replication, the

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 1P: Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724...

See similar textbooks

Related questions

Q: The partial sequence of one strand of a double-stranded DNA molecule is…

A: Restriction endonucleases are the enzymes used in genetic engineering or DNA cloning in which…

Q: RNA interference is mediated by: a. miRNA b. tRNA c. sgRNA d. mRNA

A: RNA stands for ribonucleic acid. The RNA is produced by the process of transcription. The RNA…

Q: Gymnosperms have ___________ but no fruits or flowers.

A: Two terms are very common in the plant kingdom - Gymnosperms and Angiosperms. Angiosperms are the…

Q: Question 34 Which characteristic is shared by a cell membrane and a chylomicron? Both contain…

A: Introduction:- All lipid molecules in cell membranes are amphipathic (or amphiphilic), meaning they…

Q: Identify the correct mRNA that will be produced from this NON-TEMPLATE or CODING strand: TAG CCG ATG…

A: The coding strand is the DNA strand whose base sequence is similar to its primary transcript (RNA).…

Q: 11. Tube the carries sperm from epididymis to urethra during ejaculation. 12. Thick whitish fluid…

A: (According to Bartleby guidelines, only the first three subparts have been answered. Kindly post the…

Q: Which is predatory, uses fours leg, and the males have wings? A. Embiidina B. Dermaptera C.…

A: Insect with four legs and male bearing wings :-

Q: Larvae and pupae per Bt plant 100 Ö TOKH company -- Mosaic, Cry1Ac plant --- Mosaic, Cry1C plant --…

A: Mosaic treatment of plants and density of moths after treatment.

Q: What is the effect of linkage and recombination on gamete genotypes?

A: Nucleus is a main controller of the cell which comprises of thread like structure known as…

Q: BIOLOGY 123, SPRING 2022 LAB STUD Q13. Using examples, explain why the genetic code is considered…

A: Q. Using examples, explain why the genetic code is considered redundant but not ambiguous.

Q: Which of the following descriptions of regions A, B, and Care INCORRECT? A = minor groove, sugar…

A: On one side of the helix, the strand backbones are closer together than on the other. When the…

Q: What are the factors that must be considered in formulating diets for farm animals? Briefly explain…

A: Diet planning is an integral aspect of any daily feeding strategy. It is a method of accomplishing…

Q: Which group of insects is known as a vector of several diseases to humans? A. Diptera B.…

A: There are a number of diseases which are spread by insect vectors such as malaria, dengue,…

Q: Identify the INCORRECT match between a situation and whether it is a case of Biosafety, Biosecurity,…

A: Biosafety and biosecurity rules.

Q: In corn, purple kernels (P) are dominant over yellow kernels (p) and round kernels (R) are dominant…

A: The chi-square analysis is used in different experiment to compare the observed and expected data.…

Q: Two gene loci, A and B, are on separate chromosomes and alleles A and B are dominant over alleles a…

A: Dihybrid cross Is a mating experiment involving two creatures that are genetically identical in two…

Q: [Select] Table 2 [Select] Xgal glucose Xgal + lactose Minimal lactose [ Select] [Select] ΝΑ [Select]…

A: X gal itself is colorless compound . X gal + lactose a mutated colony will represented by white…

Q: Lipids forms membranes due to the effect of hydrophobicity that promotes self-association. O True…

A: Introduction Lipid:- A lipid is any of various organic compounds that are insoluble in water but are…

Q: See question 3. Is the shaded recessive or dominant and tell me exactly were to circle please.

A: The pedigree analysis helps us to identify the mode of inheritance of a particular disease and also…

Q: RE: Which cellular organelles contain DNA? The cellular organelles that contain DNA are the nucleus,…

A: A cellular organelle is a distinct structure found within a cell, and there are numerous types of…

Q: What are the major elements of the eukaryotic cytoskeleton and what are their properties? Which of…

A: The eukaryotic cytoplasm contains a set of long thin fibres called the cytoskeleton. The cytoskelton…

Q: (i) C. (ii) D. (a) Name the type of blood vessel labelled 4 D- 5 ES 6 Lungs Heart Body organs B

A: In any organism, the heart's job is to keep "blood" flowing constantly throughout the body. Blood…

Q: 12 Vertebrates Deuterostomes other Lophotrochozoa other Arthropods Mollusks Radiata Porifera Fungi…

A: Taxonomic distribution of the species found in the Rabosky's study.

Q: The karyotype below belongs to a male with Down Syndrome. K 00 B 18 88 88 88 88 88 13 88 Bo X 00 00…

A: The representation of all the chromosomes inside the cell of a person is called karyotype. The…

Q: Which is considered most primitive? A C B D

A: Introduction The given figures belong to the class Cephalopoda, which also includes squid,…

Q: Which of the following could be reasons why population sizes may reach and maintain plateaus? Select…

A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…

Q: Brains make more than one kind of mind because although we all have the same basic macrostructure of…

A: The brain is a complicated organ which controls every action in our body, including thought,…

Q: During muscle contraction, which of the following processes takes place? Select one: O a. AMP…

A: Please follow step 2 & 3 for detailed explanation.

Q: Question 24 Match the lipoprotein or reaction based on the lipid transport pathway shown: DIETARY…

A: The blanks are filled as follows and the option is assigned to the right place.

Q: In an experiment, the bacteria were placed in dropper bottles containing glycerol as a carbon…

A: The purpose is to kill any previous bacteria on the loop before it is exposed to the bacteria. The…

Q: auditory nerve

A: Auditory nerves and the brain Nerve impulses are transmitted from the ear to the brain via the…

Q: 4) Identify three positions of the patient to obtain a BP. a. b. C.

A: Possible body positions for taking BP can be Prone Supine Upright

Q: What role do hydrogen ion play in the generation of ATP in cellular respiration

A: Cellular respiration is a group metabolic process used by every living organism to produce energy in…

Q: 1) Explain why the process of DNA replication is slower on the lagging strand than on the leading…

A: DNA replication is a process in which from one Duplex DNA ,two identical copies of DNA is…

Q: Which is TRUE about the diagram below? -00-00-00 The green part of the neuron is the axon terminal.…

A: Neurons are the vital structure in the nervous system which helps in transmission of signal impulse…

Q: what if a mutation resulted in the enzyme DNA polymerase III being non-functional? How would that…

A: The mutation is defined as the change in sequence of nucleotides in a gene. The mutation can either…

Q: . What is the pattern of inheritance for the first generation? 5. What is the pattern of inheritance…

A: An individual's phenotype is termed that they are typically described and has been referring in the…

Q: (Heart) Which interval is the longest: a. between beginning 1st sound and end of 2nd sound? b.…

A: Heart echocardiography is quickly becoming a routine treatment technique for a wide range of cardiac…

Q: If there is a defect in the anterior pituitary gland, what should the levels on the below be? *high…

A: Cortisol Releasing Hormone is released from the hypothalamus. CRH stimulates the anterior pituitary…

Q: Decreased prod A) Estradiol B) Inhibin OC) Progesteron D) Prolactin OE) Prostate-spe

A: FSH or Follicle stimulating hormone maintains the correct level of testosterone hormone. When the…

Q: 2 events that happen in meiosis that do not happen in mitosis and explain what happens during these…

A: In this question we have to describe about cell division . See full answer in step 2.

Q: Which of these methods will allow visualization of protein localization in a cell? a. Flow Cytometry…

A: Protein localization is the technique which allows the visualization of a protein inside the cell.…

Q: Explain Mendel's Law of Segregation and Independent assortment by connecting them to the process of…

A: Please follow step 2 for detailed explanation.

Q: Match the letters in the empty boxes to the correct words or structures. A B C D E F G Citric acid…

A: Cellular respiration is a metabolic process in which glucose molecule is used up in the synthesis of…

Q: Examine the pedigrees and then answer the questions that follow. Note: we are only considering…

A: Genetics is a branch of biology involved in the study of genes, genetic variation, and heredity in…

Q: This first question asks you to group the different answers into the correct category. Our two…

A: Anabolism uses energy to generate chemicals that the body need for proper operation. Catabolism, on…

Q: Which of the following lipids is not hydrolysable? O sphingolipids O sterols O phospholipids O…

A: Introduction Lipids are important to our body as they store energy, as well as they are required for…

Q: How many generations are in this pedigree? What sex is the youngest child in

A: Each member in a Pedigree represent whether he is affected or not according to the inheritance…

Q: Peripheral proteins are proteins in the lipid layer facing inside the membrane True False

A: Cell membrane also called as plasma membrane are generally made up of by phospholipid bilayer in…

Q: D- Lungs Heart 4 Body organs (a) Name the type of blood vessel labelled (1) C. (ii) D. (b) In which…

A: The heart is a muscular organ about the size of a fist, located just behind and slightly left of the…

Question

Question 9

doesn't add deoxyribonucleotides to the 3 end of promer. Hence,
suncion properly. The bir pay comp
Q9. Recall that DNA and RNA strands are always read in the 3'5' direction but that DNA
and RNA sequences are always synthesized in the 5' 3' direction. Consider the following
DNA sequence:
L
GGUAVAVAVACAAUQUC UU
5'CCATATATATGTTACAGAAAGCGCTGGCTGTTTGACTGACT3'
3' GGTATATATACAATGTCTTTCGCGACCGACAAACTGACTGA5'
CCAUAVAVAUGUUACAGAA AG CUGGCUGUVUGACUGACU
ACUGA
ons
2=UAA
AUG a) Paying attention to where transcription starts (after the promoter), identify (circle)
the bases in the bottom strand that will code for start and stop codons. Write the
mRNA sequence that would be transcribed if the top strand served as the
template.
*
5.
b) Write the amino acid sequence that would be translated from the mRNA
sequence you just wrote.
8
will og PNA is not produced in the process of replication. The
will lead to stop the
replication process. In absence 156 | Pag
of replication, the cell will not divids further.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

a) Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR: 3’ UTR:
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
Given the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’
Given the choices,a. 25b. 18c. 23d. 21how many hydrogen bonds are present in a DNA double helix fragment consisting of the following sequence in one strand: ATTGCGGTCA
Basisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde / Human DNA sequence ATG TGT CCA TTA ACG TGC ACA Name the codon that is formed from base triplet number 2 on the DNA sequence. Write down the names of the amino acids coded for by base triplets 6 and 7. Write down the full names Draw the structure of the dipeptide Thr-Cys at pH7. Clearly indicate the following: the amino terminus (N) the carboxyl terminus (C) a peptide bond an α-carbon atom If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed? E.The following is a sequence of base triplets in DNA F.If guanine, found in the first base…
Let’s return to your patient with sickle cell anemia. Below is the RNA sequence from your patient and from her mother. (The ••• represents another 30 nucleotides not written out here). The affected nucleotide is indicated in BOLD. Patient’s RNA: 5’ –CUAUGACAGAGUUC•••CAUUAGCCA – 3’ Mother’s RNA: 5’ –CUAUGACAGUGUUC•••CAUUAGCCA – 3’ A) Write out the first 10 nucleotides corresponding to the DNA sequence of the coding strand for your patient in the 5' to 3' direction. B) From the information you have been given, why is it not possible to accurately write out the DNA sequence as it would really be found in the genome? (ie, what you wrote down in part A is NOT necessarily what the DNA sequence would really look like if we could examine the chromosome directly - why? And no this has nothing to do with the 30 nucleotides that aren’t written out or the mutated base). Your answer should be 1-2 sentences maximum.
PLEASE FL OUT TABLE USING INSTRXUTIONS -USE BASE PAIRING RULES TO COMPLETE SECOND COLUMN FOR EACH MUTATION WRIYE IN ANY MRNA DOEONS RHAT WILL BE FHANGED AS THE REEULR OF RHE MURATION AND USE X MARKS RO INDÍCATE DOONS THAT WONT BE FHANGES CIRCLE STOP CODONS
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH
Please explain it simply, and don't over-explain. Thanks! A. How is DNA structure arranged to allow it to do its function?
The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If the primer in a dideoxysequencing experiment anneals just to the left of this sequence, drawthe sequencing ladder that will be obtained.
Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to C‑terminal direction. Note: Enter the amino acids using their three-letter designations. Put a hyphen between each amino acid.
The coding (or “sense”)strand(again noticename ANDthe directionality)of DNAthat is known to encode the C-terminal end of a long E. coliprotein has the following nucleotide sequence:5′–CCATGCAAAGTAATAGGT–3′Give the sequence of the last three amino acids of the protein (label the C-terminus).