The coding (or “sense”)strand(again noticename ANDthe directionality)of DNAthat is known to encode the C-terminal end of a long E. coliprotein has the following nucleotide sequence:5′–CCATGCAAAGTAATAGGT–3′Give the sequence of the last three amino acids of the protein (label the C-terminus).

The coding (or “sense”)strand(again noticename ANDthe directionality)of DNAthat is known to encode the C-terminal end of a long E. coliprotein has the following nucleotide sequence:5′–CCATGCAAAGTAATAGGT–3′Give the sequence of the last three amino acids of the protein (label the C-terminus).

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Given the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’
The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?
Please by using the first base of each as the first triplet in a condo, how do I translate two almost identical RNA strand into sequences? You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain. aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What amino acids are encoded by this sequence?
A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) isconstructed, will its melting temperature be higher or lower?
a) Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR: 3’ UTR:
Below is a polinucleotide sequence of the non-template strand of a coding DNA sequence. Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic information to protein sequence as described by the so-called “Central Dogma” . Clearly indicate the direction of your polynucleotide strands and peptide/protein. Example: (USE SPACES BETWEEN CODONS): ' XXX XXX XXX XXX ' Example: (USE SPACES BETWEEN AMINOACIDS): Polypeptide: direction-XXX-XXX-XXX-direction ATG GCA TGC AAT AGC TCA TGC b) What would happen to the amino acid sequence if the underlined nucleotide (C) would change to an A? (3
A closed circular duplex DNA has a 100-bp segment of alternating C and G residues. On transfer to a high salt solution, the segment undergoes a transition from the B conformation to the Z conformation. What is the change in its linking number, writhing number, and twist?
The restriction endonuclease PstI cuts DNA symmetrically on both strands at the sequence: CTGCAG GACGTC On the resulting DNA fragments are left 3’ overhanging ends of 4 nucleotides. PstI cleavesthe phosphodiester backbone with a-type specificity. In short-hand notation, showing theidentity of phosphates on the ends, draw the two fragments that result from PstI digestion ofthe following double-strand ed oligonucleotide: 5’-pAATTGCTACTGCAGAACCGG-3’ 3’-TTAACGATGACGTCTTGGCCp-5’
The following segment of DNA in a hypothetical model organism encodes a polypeptide containingSEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA tripletsencoding the translation initiation (or start) codon and a stop codon are included in the sequence.3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine theamino acid sequence of the polypeptide (use three letter codes for the amino acids) andidentify the N- and C- terminal ends of the polypeptide. please help. I am confused. c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules(like water)? Place a circle around these.d. Some amino acids on a polypeptide can be modified post-translationally. Thesemodifications may have some effect on the function of the…
A small section of bacterial enzyme has the amino acid sequence arginine, threonine, alanine, and isoleucine.The tRNA anticodons for the amino acid sequence shown above is a. GCA UGC CGA UAC b. GCC UGA CGU UAG c. CGA AGA GCC AUA d. GCG UGG CCC UAA