After Drosophila DNA has been treated with a restriction enzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun” technique, every DNA sequence of Drosophila in a library can be recovered.a. How would you identify a clone that contains DNA encoding the protein actin, whose amino acid sequence is known?b. How would you identify a clone encoding a specific tRNA?

After Drosophila DNA has been treated with a restriction enzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun” technique, every DNA sequence of Drosophila in a library can be recovered.a. How would you identify a clone that contains DNA encoding the protein actin, whose amino acid sequence is known?b. How would you identify a clone encoding a specific tRNA?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

After Drosophila DNA has been treated with a restrictionenzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun”technique, every DNA sequence of Drosophila in a librarycan be recovered.a. How would you identify a clone that contains DNAencoding the protein actin, whose amino acid sequenceis known?b. How would you identify a clone encoding a specifictRNA
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region. 4C. In NOT more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus?
a. What sequence information about a gene is lackingin a cDNA library?b. Can clones in a cDNA library contain 5′ UTR sequences? 3′ UTR sequences?c. Would you be likely to find on average longerORFs in cloned sequences from a genomic libraryor from a cDNA library? Explain
The chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC. 2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?
Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving human DNA with Haeiii in such a way that the DNA is only partially digested; that is, not all the possible HaeIII sites have been cleaved. What is a possible reason for doing this?
in the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
If you wanted to express a library of human proteins in yeast, there are several good reasons why it would be better to use a cDNA library instead of a genomic library from humans. Which one of the following options is not such a reason? a. yeast may not initiate transcription or splicing of a human gene at the correct locations b. some genes will have very high representation (many plasmids contain the gene), while others will have very low representation (few or no plasmids contain the gene) in the cDNA library c. most genomic library clones would be useless, because only ~1.5% of the human genome actually encodes proteins d. a cDNA library can contain multiple splice variants, which are common for human genes e. introns are often very large in the human genome, making it impossible in many cases to contain a genomic version of an entire gene in a single plasmid
You were going to sequence a rice DNA fragment whose sequence was only know at one end, as shown below. 5’ AAACGATCGAGTCGCATCCAAAATCGATACCC—unknown region 3’ TTTGCTAGCTCTGCGTAGGTTTTAGCTATGGG—unknown region After several tries, you obtained a beautiful sequencing image as shown here: The worked out well partially because you had designed a primer for sequencing the unknown region according to the following guideline: Tm is 55 – 60°C. Ensures primer had a appropriate melting temperature for PCR ans sequencing. The GC content of the primer is the same as the genome/template (rice = 60%, human/Drosophila = 45-50%). A same nucleotide cannot be more than 2 in a row, e.g. CCC, GGGGG, AAA. The secondary structure of the primer must be none or weak. No primer dimers (The primer anneals to itself). 3’ end is the most important: it should not end in A, preferably ends in GG, GC, CG or CC This website can help you design the primer: http://www.oligoevaluator.com/OligoCalcServlet…
Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA. (a) How many exons does the gene contain? How many introns? (b) Where in this structure would you expect to find a 5′,5′-internucleotide bond? Where would you expect to find a polyadenylic acid sequence?
Knowing that you are using HindIII and EcoRI to cut your plasmids, and that those two enzymes cut within the MCS, use the map of pUC19 provided below to compute: What will be the sizes of the 2 restriction fragments if NO insert is present in pUC19? What will be the sizes of the 2 restriction fragments if the approximately 317 bp RT-PCR product (insert from WT satC dimer) was ligated successfully into the SmaI site? What will be the sizes of the 2 restriction fragments if TWO approximately 317 bp RT-PCR products (2 ligated inserts from WT satC dimer) were ligated into the SmaI site?
The sequence below shows 140bp of a double-stranded DNA sequence coding for histone H2A. What two primers could be used to amplify the whole 140bp sequence in a PCR reaction? 1 70ATGTCTGGACGTGGCAAGCAGGGAGGCAAAGCCCGCGCTAAGGCCAAGACTCGCTCTTCTAGGGCCGGTCTACAGACCTGCACCGTTCGTCCCTCCGTTTCGGGCGCGATTCCGGTTCTGAGCGAGAAGATCCCGGCCAG 71 140 TCCAGTTCCCCGTGGGCCGAGTGCACCGCCTGCTCCGCAAAGGCAACTATGCCGAGCGGGTCGGGGCCGGAGGTCAAGGGGCACCCGGCTCACGTGGCGGACGAGGCGTTTCCGTTGATACGGCTCGCCCAGCCCCGGCC a. TACAGACCTGCACCGTTC and GGCCGGGGCTGGGCGAGC b. ATGTCTGGACGTGGCAAG and CCGGCCCCGACCCGCTCG c. ATGTCTGGACGTGGCAAG and GCTCGCCCAGCCCCGGCC d. TACAGACCTGCACCGTTC and CGAGCGGGTCGGGGCCGG