AKS 5c1: Use the model below to answer the question that follows. Which interpretation of this model is most accurate? * DNA MANA Transcription Mature MANA Nucleus Transport to cytoptam o pron syh ation mANA Cell membrane This model represents protein synthesis since the TRNA is delivering amino acids to form a polypeptide chain that will form a protein. This model represents protein synthesis since the tRNA is delivering lipids which will be used to bond proteins to form an enzyme. This model represents protein synthesis because DNA is being copied during transcription in the nucleus before leaving the nucleus. This model represents protein synthesis because mRNA is coiling to form a new protein molecule in the cytoplasm.

AKS 5c1: Use the model below to answer the question that follows. Which interpretation of this model is most accurate? * DNA MANA Transcription Mature MANA Nucleus Transport to cytoptam o pron syh ation mANA Cell membrane This model represents protein synthesis since the TRNA is delivering amino acids to form a polypeptide chain that will form a protein. This model represents protein synthesis since the tRNA is delivering lipids which will be used to bond proteins to form an enzyme. This model represents protein synthesis because DNA is being copied during transcription in the nucleus before leaving the nucleus. This model represents protein synthesis because mRNA is coiling to form a new protein molecule in the cytoplasm.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 12RQ: How do enhancers and promoters differ? Enhancers bind transcription factors to silence gene...

See similar textbooks

Similar questions

2 paragrapghs the potential uses of stem cells in research and/or medicine
Compare and contrast the intrinsic and extrinsic apoptosis pathways. Please keep brief - 3 sentences/dot points each.
5. How the modification and histone interaction with DNA brought to transcriptional silencing. Use Saccharomyces cerevisiae as example to explain the question. Write a short essay. Please answer asap and in short and content should not be palgarised please
How gene expression is controlled? (min 500 words)
Please answer fast Give ans for each statement 1.A protein linked to a disease state is being studied by scientists. They discover that the disease protein has the same amino acid sequence as the protein in healthy people. State right or wrong: Does the following explanation provide a plausible biological explanation for the disease state? a.The RNA polymerase does not correctly read the codon code on the mRNA. b.The protein is not being regulated properly. c.The disease protein is incorrectly folded. d. The disease protein lacks a post-translational modification. e.The protein amounts differ because they are expressed differently.
During gene expression, which information flows in the correct order? A. RNA --> Transcription--> DNA B. Proteins --> Translation --> RNA C. DNA --> Transcription --> RNA D. RNA --> Transcription --> Proteins E. DNA --> Translation --> RNA
GGGAGTGTATACGGGATGAAGGCGATT MRNA What’s the Protein And what’s the phenotype
18) which of the following statements is correct? A proteins make MRNA which then makes genes B genes make proteins which then make mRNA C genes make mRNA which then make proteins d- MRNA is make proteins which then make genes E- MRNAs make genes which then make proteins
Mention important functions of apoptosis & autophagy.
Which statement(s) describe the function of the protein encoded by KMT2D ? Transcription factor involved in the DNA damage response. A component of haemoglobin. A subunit of - secreatase. An enzyme invovled in nucleotide biosynthesis. An enzyme involved in the breakdown of glycosaminoglycans (GAGS). Involved in fat and muscle cell differentiation A cell surface protein involved in iron absorption.
DO NOT COPY IN GOOGLE OR BARTLEBY QUESTIONS: - WHEN do you think apoptosis occurs in humans? - What would be the effect if apoptosis doesn't happen? EXPLAIN YOUR ANSWER.
What will result from the binding of a transcription factor to an enhancer region? decreased transcription of an adjacent gene increased transcription of a distant gene alteration of the translation of an adjacent gene initiation of the recruitment of RNA polymerase