8. Label each figure with what TYPE OF CELL is undergoing gene expression: Nuclear membrane DNA Cytoplasm Plasma membrane Nucleus Cytoplasm Mature mRNA Pre-MRNA MRNA DNA Protein Ribosomes Protein Ribosomes

8. Label each figure with what TYPE OF CELL is undergoing gene expression: Nuclear membrane DNA Cytoplasm Plasma membrane Nucleus Cytoplasm Mature mRNA Pre-MRNA MRNA DNA Protein Ribosomes Protein Ribosomes

Name: 8. Label each figure with what TYPE OF CELL is undergoing gene expres
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 8. Label each figure with what TYPE OF CELL is undergoing gene expression:Nuclear membraneDNACytoplasmPlasma membraneNucleusCytoplasmMature mRNAPre-MRNAMRNADNAProteinRibosomesProteinRibosomes

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter15: Studying And Manipulating Genomes

Section: Chapter Questions

Problem 3SQ

See similar textbooks

Similar questions

Mechanisms that govern gene expression do not operate during ___ . a. transcription b. RNA processing c. translation d. knockouts
A chromosome contains many different genes that are transcribed into different ___ . a. proteins b. polypeptides c. RNAs d. a and b
A gene that is knocked out is ________. a. deleted b. inactivated c. expressed d. either a or b
1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'
Predict the sequence of amino acids coded by the mRNA sequence 5’ GGA–GGC–ACA–UGG–GAA 3’
Translate the mRNA sequence of HBs mRNA 5'- AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU -3'
If the sequence of the coding strand in a transcription unit is writtenas follows:5' -ATGCATGCATGCATGCATGCATGCATGC-3'Write down the sequence of mRNA
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand in mRNA. Label the 5’ and 3’ ends. Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins.
18) which of the following statements is correct? A proteins make MRNA which then makes genes B genes make proteins which then make mRNA C genes make mRNA which then make proteins d- MRNA is make proteins which then make genes E- MRNAs make genes which then make proteins
1. Bradykinin peptide: a) The sequence of the gene that encoded it, indicating with different colors, the direction, its components and the part of the cell where it occurs with the name of this stage. b) The sequence of the mature mRNA, indicating with different colors the structure of its components and the site of the cell with the name of the stage where it occurs. c) Mention the site of the cell where the bradykinin peptide was synthesized. d) In the DNA sequence make a point mutation by substitution, indicate with a different color the site and the effect it will have on the respective codon and to which amino acid it will be translated. 2. Based on the answer in (a), use the DNA sequence of bradykinin to describe the outcome of the replication step. 5. You have the picture of DNA transcription and mRNA translation between prokaryotic and eukaryotic cells.Instruction: Make a comparative chart showing the differences between the two cells. (image) 7. Methylations. Describe…
A gene with the following DNA sequence is transcribed and translated: 5’ TAGCTACGGAAAGCGTACACGGACT 3’ Briefly explain how the above mentioned DNA sequence will be transcribedto RNA.
5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’ Label the sense and antisense strands and what direction will the RNA polymerase travel to make the mRNA? Transcribe the DNA into mRNA (Include polarity)and translate the mRNA into a polypeptide chain (Include polarity)