AKS 5c1: Given the statements below, what is the correct sequence of events for protein synthesis? * 1. DNA is used as a template to create MRNA 2. Amino acids are bonded together to make a polypeptide 3. MRNA molecule binds to a ribosome 4. The ribosome releases both the mRNA molecule and the polypeptide 5. TRNA binds to the ribosome 1, 2, 3, 4, 5

Q: Give the correct biological term for each of the following: 1.1 Portion of DNA which carries the…

A: Transcription must happen where DNA can be found because, DNA is the prime molecule which is giving…

Q: Explain the functions of centrosome?

A: Centrosomes are cell organelles that are formed from an arrangement of two barrel-shaped clusters of…

Q: explain what happens in transcription?

A: Transcription is the interaction by which the data in a strand of DNA is replicated into another…

Q: Describe the process of protein synthesis and associated post translational modifications.

A: Post-translational modification (PTM) refers to the covalent and generally enzymatic modification of…

Q: 22-69 Indicate whether each of the following statements relating to protein synthesis is true or…

A: The process in which the formation of proteins occurs is called protein synthesis. It is the main…

Q: C 3. The principle theme in biology is DNA transcribes to RNA and RNA translates to proteins. Place…

A: DNA is ladder like , two strand structure that act as genetic material in most of Organism.…

Q: 5. Answer the following questions concerning protein synthesis a. Describe with drawings how…

A: Protein synthesis is known as translation process that perform synthesis of amino acid chain or…

Q: I NEED HELP SOLVING THIS CONCEPT MAP ON PROTEIN SYNTHESIS.

A: Protein synthesis is the process where biological cells generate new proteins.

Q: Define the role of ribosomes in protein synthesis

A: Ribosomes are one of the many organelles present in the cell. It is mainly made of rRNA and has two…

Q: DOWNLO T O- : Tools 4. In your own words, write a brief description of the events that occur in each…

A: Transcription is the method of copying information from a strand of DNA into a new messenger RNA…

Q: Number the following steps of protein synthesis in order in which they occur, starting with 1 and…

A: Translation - it the process in which proteins are formed from ribosomes particularly,from mRNA…

Q: 6 What is the complement of the mRNA triplet code in the tRNA? 7 In what way is tRNA different from…

A: RNA molecules are also called ribonucleic acids. RNA is composed of nucleotides attached with each…

Q: NA contains the information that a cell uses to synthesize a particular protein. How do proteins…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: explain the roles of rRNA, mRNA, and tRNA and of ribosomes in protein synthesis

A: The process of protein synthesis is accomplished through translation. Translation is a process of…

Q: AKS 5c1: Which of the following models BEST represents protein synthesis? * O MRNA (UAC AAA) DNA…

A: Gene expression is the process of three consecutive steps namely replication, transcription, and…

Q: Match the following with the correct process. converts DNA into mRNA occurs in the ribosome 1.…

A: All new proteins in the cell are formed by conversion of DNA to amino acids.  conversion of DNA to…

Q: Put the following steps of protein synthesis in order: STEP A - Anticodon attaches to the mRNA STEP…

A:

Q: Number the following steps of protein synthesis in the order in which they occur, starting with 1…

A: Central dogma involves transcribing the information from DNA to RNA and from RNA to protein…

Q: Synthesis of RNA from the instructions in DNA is called________ . Synthesis of a protein from the…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: which does not play a role in translation?

A: The translation is the process in which the message coded by an mRNA is translated into a sequence…

Q: AKS 5c1: The model below represents the process of protein synthesis. What is the best description…

A: Central Dogma of Molecular Biology explains the flow of information from DNA to RNA and then to…

Q: During protein synthesis, which of the following are involved in the steps that take place in the…

A: Protein synthesis takes place via a process called translation . Before translation  mRna have to be…

Q: How to transfer biological information in protein synthesis? What is the link between DNA and…

A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…

Q: AKS 5c1: The model below shows the process of protein synthesis. What is the best explanation for…

A: DNA (Deoxyribonucleic acid) is the hereditary material present in most of the living organisms,…

Q: 1.What is corresponding amino acid chain of the mRNA sequence AUG-CGU-UCU-GCU GGU-UAG? 2. What are…

A: Eukaryotes and Prokaryotes store genetic information in form of DNA and RNA. Some of them have…

Q: Put these events of protein synthesis in the correct order First [Choose] [Choose ] RNA nucleotides…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: Which sequence best represents the correct order of these stages?     2-1-3-4     2-3-1-4…

A: The Central dogma of molecular biology suggest that the expression of the genes occurs in the three…

Q: AKS 5c1: Which of the following demonstrates the correct sequence of events that occurs during…

A: The correct sequence of events is given below.

Q: Using a diagram, outline the structure of a ribosome, including protein and RNA composition, large…

A: Ribosomes are sphere shaped structures located within the cytoplasm of a cell. They remain free in…

Q: Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence:…

A: Amino acid for AUG is Methionine Amino acid for CGA is Arginine Amino acid for CCU is Proline Amino…

Q: C9. The peptide “backbone" consists of repetitive "“units" of amino group nitrogen-alpha…

A: Proteins are biopolymers made of amino acid units. Amino acids are comprised of carbon, hydrogen, a…

Q: question #3

A: Ribosomes are known as protein factories of the cell. They are of two types- 1. Prokaryotic…

Q: State some functions of nucleolus.

A: The nucleolus is a dark-stained structure located in the nucleoplasm of the nucleus. It is composed…

Q: 1. Using the DNA provided transcribe DNA into MRNA. 2. Use the mRNA strand you created and break it…

A: # According to our guideline we can answer maximum three sub parts of a questions. So, upload the…

Q: What are the different types of RNA and their contributions to the process of Protein Synthesis?

A: a. messenger RNA (mRNA) b. ribosomal RNA (rRNA) c. transfer RNA (tRNA)

Q: b. 3, 20, C. 4, 20 d. 20, 4 necessary for protein synthesis to occur: a tRNA b. MRNA c. ribosomes d.…

A: The process of transcribing a piece of DNA into RNA is known as transcription. Messenger RNA is made…

Q: Answer the following questions: 1.) In your own words, describe the different steps in prorein…

A: Protein synthesis is the process by which proteins are formed in biological cells.

Q: How many codons are there in the mRNA?

A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…

Q: 10. A portion of an mRNA molecule has the sequence 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence…

A: 1. The genetic code is the set of rules followed by cells to read and translate the genetic…

Q: DNA: CATCTACAAATAGCACCTAATTGTG What would be the MRNA:? Protein? Phenotype?

A: CAT  CTA  CAA  ATA  GCA  CCT  AAT  TGT  G           (DNA)

Q: How might protein synthesis execute differently if a mutation occurs?

A: point mutations occur  on a single nucleotide in the DNA, these can result in codon differences in…

Q: 1. Decoding mRNA into amino acids is called translation.

A: above given statements are about transcription, translation process and how amino acids makes a…

Q: Below are the general steps of protein synthesis. What is the correct sequence of protein synthesis?…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: a) What is the role of the lysosome in degrading proteins? What are the enzymes that…

A: a)  Lysosomes are single membrane-bound organelles present in animal cells. Lysosomes have acidic…

Q: Below are the general steps of protein synthesis. What is the correct sequence of protein synthesis?…

A: The process of synthesis of proteins is called translation. Proteins are synthesised in a cell in…

Q: Describe the relative roles of DNA and RNA  in protein synthesis?

A: DNA molecules are the storage for the genetic information but they cannot do anything by itself. RNA…

Q: Protein synthesis, begins with a process known as pre-initiation. Explain three scenarios that would…

A: Initiation factors are proteins binding to the smaller subunit of the ribosome during the initiation…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.