Put these events of protein synthesis in the correct order First [Choose] [Choose ] RNA nucleotides attach along exposed DNA codons TRNA brings amino acids to ribosome polypeptide is formed MRNA transcript peels away from DNA ribosome attaches to mRNA Second Third MRNA leaves the nucleus DNA unzips MRNA is edited
Q: TRNA has peptidal transferase activity. True False Genetic information stored in mRNA is translated…
A: A ribosome is a biological unit made up of Protein molecules and RNA that functions as the cell's…
Q: Which of the following step acts before the others in pro ribosome large subunits binds to mRNA TRNA…
A: The translation process completes in three main steps. they are initiation, elongation, and…
Q: Translation begins with the_______ codon of mRNAand continues until a(n)_______ codon is reached.…
A: For the expression of a gene, the sequence present in a DNA molecule must be converted into a RNA…
Q: Sequence of nucleotides in MRNA|AUGCGUUCAUGGACU Sequence of amino acids in protein
A: Sequence of nucleotide in mRNA AUGCGUUCAUGGACU is given .
Q: If you remove the terminator from a gene, how will this disrupt the function of RNA polymerase?…
A: Transcription is the process of conversion of all the information from the DNA into mRNA in the cell…
Q: The ribosomes ratchet back and forth with every pt'ase reaction in order to move the tRNAS and the…
A: During translation, tRNAs carry amino acids to the ribosome and join with their complementary…
Q: Use one of the vocabulary words to fill in the blank. Check your spelling. Key Vocabulary from Unit…
A: The ribosome is a special organelle in the cell that is responsible for protein production. The…
Q: Explain why the statement is correct. A section of the mRNA has a nucleotide sequence of…
A: mRNA A single stranded RNA which is copied from DNA and contains gene or information about specific…
Q: During translation, small organelles called ____ read the mRNA sequence. These organelles direct…
A: Protein synthesis is a complex process and requires sequential steps of transcription and…
Q: Which components will end up in the final, fully processed mRNA in a eukaryotic cell? Choose all…
A: The m RNA that is formed by the process of transcription from DNA is subjected to pre-processing in…
Q: Which sequence regarding protein synthesis is correct?a. translation → transcription → mRNA…
A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…
Q: Figure out which RNA and DNA would code for the following sequence of amino acids (multiple answers…
A: The transcription is the process by which RNA is generated from the DNA template. This process…
Q: Choose the answer that has these events of protein synthesis in the proper sequence. (Note some…
A: The steps of Protein synthesis are collectively called translation it involves forming proteins…
Q: mRNA binds to a ribosome. Transcription completes. mRNA leaves the nucleus. tRNA attaches to the…
A: Translation is a process which means Protein synthesis And prior to this Transcription completes in…
Q: mRNA binds to a ribosome. Transcription completes. mRNA leaves the nucleus. tRNA attaches to the…
A: DNA translation is the term used to portray the course of protein synthesis by ribosomes in the…
Q: Part A Which of the following processes is represented in the figure below? 3' AAG UGA RF1 RF2 O…
A: Thank you for the question Answer :- The given picture shows translation termination Explanation :-…
Q: How many ribosomes can bind an mRNA molecule and translate into a protein at the same time?
A: The m RNA formed at the end of the Transcription will move on to the cytoplasm for the translation…
Q: Draw/Diagram how translation starts at the N-terminus of a protein. Include the ribosome and label…
A: It is the process of the formation of proteins by the process of Translation. The proteins are…
Q: Which of the following statements about mRNA is INCORRECT? A. the sugar moiety of mRNA is D-ribose…
A:
Q: In transcription, the nucleotide sequence CAATGGC in DNA would code for [1] in mRNA. O GTTACCG O…
A: The genes are the segments of DNA which carries information for the synthesis of the functional…
Q: Directions: Sequence the following steps in protein synthesis from first to last. Write only the…
A: TRANSLATION is the process by which a protein is synthesized from the information contained in a…
Q: During protein synthesis, which of the following are involved in the steps that take place in the…
A: The central dogma of life is as follows DNA - RNA - Protein Thus to make protein we require RNA…
Q: The job of a ribosome is to: make an mRNA transcript of DNA synthesize a new strand of DNA using the…
A:
Q: What does mRNA copy from DNA? * One gene's worth of nucleotides One chromosome's worth of…
A: Transcription is the process of synthesis of mRNA from the DNA. It takes place in the nucleus.
Q: Sequence the following steps in protein synthesis from first to last. Write only the numbers (1-6)…
A: Protein synthesis refers to the process of formation of protein molecules by the cells of an…
Q: AKS 5c1: Which of the following demonstrates the correct sequence of events that occurs during…
A: The correct sequence of events is given below.
Q: What process occurs before the other? Transcription and then lonization Translation and then…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: Which of the following have codons? amino acids acetyl transferase FRNA RNA polymerase proteins TRNA…
A: The DNA is the genetic material of the living organisms like humans. This molecule carries the…
Q: Describe the process of protein synthesis and localize where each step takes place.
A: Protein synthesis is the process wherein cells make proteins. It happens in two phases:…
Q: The ribosome recognizes and binds to the promoter region of DNA to initiate translation. true or…
A: To initiate translation a ribosome , an mRNA and an "initiator" tRNA carrying the first amino acid…
Q: Indicate the phase of protein synthesis during which each of the following processes occurs: a. A…
A: The process of synthesis of proteins is called translation. Translation occurs in mainly three…
Q: Put the following events involved with protein synthesis in order. Move first event to the top of…
A:
Q: A simplified model of protein synthesis is shown here. How might this model be revised to show a…
A: The model shows central dogma of molecular biology
Q: All of the following will move from the inside of the nucleus to the cytoplasm through a nuclear…
A: Nuclear pore complex allows the transport of molecules across the nuclear envelope. This transport…
Q: A small section of mRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids…
A: mRNA is a ribonucleotide sequence produced as a result of transcription from DNA. Once the mRNA is…
Q: which statement about genetic code is not true? A) mRNA is read 3 bases at a time, which are called…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: In the normal course of events within protein synthesis, which of the following is part of, or cal…
A: The tRNA molecule has a distinctive folded structure with three hairpin loops that form the shape of…
Q: Which type of biological molocule is being made during this process? Incoming tRNA Bound NA to Amino…
A: The figure is showing the process of translation. Translation is the process of formation of a…
Q: Juring which step of protein synthesis does a MRNA molecule turns into a protein? Which molecule…
A: Protein synthesis occurs in three steps- initiation, elongation and termination. Various amino acids…
Q: Transcribe the DNA strand into MRNA. Don't forget the spe rules for RNA! ranslate the MRNA into an…
A: Transcription is the process of producing RNA called mRNA from a DNA molecule, which codes for the…
Q: The first nucleotide in every mRNA molecule ever produced is _________ and the first amino acid of…
A: 1. Transcription - It is the process in which mRNA is formed from one of the strands of DNA (called…
Q: Below are the general steps of protein synthesis. What is the correct sequence of protein synthesis?…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…
Q: The genetic code is Random in that the codons for the same amino acid are structurally unrelated…
A: Genetic code contains information that can be used by certain organelles to translate information…
Q: Translating mRNA C G A A U G C C G U A U U C G to amino acids
A: A codon is a trinucleotide sequence of DNA or RNA that corresponds to a specific amino acid.The…
Q: Which of the following choices best match the blank? Three-nucleotide segments of RNA called…
A: Amino acids are the monomers or structural units that are responsible for protein formation. The…
Q: Each one gives some basic information and summarizes its main role in translation. mRNA:…
A: The central dogma was proposed by Francis Crick. There are three major processes: replication,…
Q: "After MRNA is made, enzymes remove introns and splice together exons in a variety of ways. This…
A: Introduction In molecular biology, messenger ribonucleic acid (mRNA) is a single-stranded RNA…
Q: during translation, each codon on the mRNA complementary base pairs with an snticodon on.....
A: Translation is the process in which proteins are synthesized by ribosomes.Translation occurs after…
Q: The job of a ribosome is to: make an mRNA transcript of DNA synthesize a new strand of DNA using the…
A: INTRODUCTION Protein synthesis is the process in which the formation of new proteins takes place. In…
![Put these events of protein synthesis in the correct order
First
[ Choose ]
[ Choose ]
RNA nucleotides attach along exposed DNA codons
TRNA brings amino acids to ribosome
polypeptide is formed
MRNA transcript peels away from DNA
ribosome attaches to mRNA
Second
Third
mRNA leaves the nucleus
DNA unzips
MRNA is edited
Fourth
(Choose )
Fifth
[ Choose ]
Sixth
[Choose]
Seventh
[Choose ]
Eighth
[Choose ]](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F5247c96e-1d1a-448a-8860-7f5cc8776456%2F8499dedf-a301-4047-b995-e73075f2e80f%2Fcuab5wt_processed.jpeg&w=3840&q=75)
Step by step
Solved in 2 steps
- A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of elF-2 alter translation? Initiation factors would not be able to bind to mRNA The large ribosomal subunit would not be able to interact with itiRNA transcripts tRNAi-Met would not scan mRNA transcripts for the start codon elF-2 would not be able to interact with the small ribosomal subunit.Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTCThen list in order the amino acids coded by this sequence.mRNA ________________________________________________________________amino acids ________________________________________________________________ 2. Sometimes a mistake occurs in the translation of an mRNA strand. Suppose that the reading of themRNA strand in question 1 began, by mistake, at the second nucleotide instead of the first. The first codonwould be AUA. Write the sequence of amino acids that would be formed.__________________________________________________________________________From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change the third base in codon 4 to show missensemutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:Identify the type of base pair substitution that you applied in codon 4
- From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:Identify the type of base pair substitution that you applied in codon 8Hi, Could you please comfirm the following question. I have selected option c) because tRNA is the the complimentary pairs of mRNA so I figured the oppside end of the tRNA would be the same as the mRNA. When I have tired to double check my answer, no tutor has selected this answer. Thank you in advance, Like mRNA, tRNA has a ribose sugar, U instead of T, and is single stranded. Unlike mRNA, which remains a long single strand of nucleotides, tRNA folds so that some areas pair up. The resulting structure has an anticodon on one end and a site for an amino acid to attach on the other end. There is base complementarity (A pairs with U and G pairs with C) between an mRNA codon and tRNA anticodon.If the amino acid lysine attaches to a tRNA, which of the following anticodons could be at the opposite end of the tRNA molecule? a. UUU and UUC b. AGA and AGU c. AAA and AAG d. UCU and UCATemplate strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
- DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading frame to:a. the rightDNA:mRNA:polypeptide chain:b. the leftDNA:mRNA:polypeptide chain:A strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.The following segment of DNA in a hypothetical model organism encodes a polypeptide containingSEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA tripletsencoding the translation initiation (or start) codon and a stop codon are included in the sequence.3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine theamino acid sequence of the polypeptide (use three letter codes for the amino acids) andidentify the N- and C- terminal ends of the polypeptide. please help. I am confused. c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules(like water)? Place a circle around these.d. Some amino acids on a polypeptide can be modified post-translationally. Thesemodifications may have some effect on the function of the…
- Plssssssssss helppppppppp, One strand of DNA reads T-A-C-G-A-G-C-T-C. Describe the steps of protein synthesis of a eukaryotic cell using the nitrogen bases of the given DNA strand. Include the following terms in your description: -DNA - mRNA -protein -tRNA -Amino acid -codon -nucleus -Ribosome -cytoplasm -transcription -translationPissssssssss helppppppppp, One strand of DNA reads T-A-C-G-A-G-C-T-C. Describe the steps of protein synthesis of a eukaryotic cell using the nitrogen bases of the given DNA strand. Include the following terms in your description (1 paragraph pls): -DNA - mRNA -protein -tRNA -Amino acid -codon -nucleus -Ribosome -cytoplasm -transcription -translationGiven this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA: polypeptide chain:
