AKS 6a/b Mutations Which of the following statements accurately describes genetic mutations? O Mutations are a natural process that increases genetic diversity. O Mutations are an unnatural process that always affect the phenotype. O Mutations are an unnatural process that are always harmful. O Mutations are a natural process that only effects genotype, not phenotype.

AKS 6a/b Mutations Which of the following statements accurately describes genetic mutations? O Mutations are a natural process that increases genetic diversity. O Mutations are an unnatural process that always affect the phenotype. O Mutations are an unnatural process that are always harmful. O Mutations are a natural process that only effects genotype, not phenotype.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 6QP: Although it is well known that X-rays cause mutations, they are routinely used to diagnose medical...

See similar textbooks

Similar questions

1) A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is copied or as the result of environmental factors. All BUT ONE of the statements below correctly describes or explains genetic mutations. A) Mutation can disrupt normal cell activity and cause diseases, like cancer. B) Mutations in parents' cells are then passed down to offspring via reproduction. C) Our cells can recognise any potentially mutation-causing damage and repair it before it permanent. D) Mutations can occur as the result of exposure to environmental factors such as smoking, toxins and radiation.
Which of the following statements best describes the outcome of a mutation? a. A mutation always results in a mutant genotype b. A mutation always results in a mutant karyotype c. A mutation always results in a mutant phenotype d. A mutation always results in a mutant protein
When gene probes, fi ngerprinting, and sequencing make it possible for you to know about genetic diseases in you or one of your children, would you wish to use this technology to fi nd out?
If you have a mutation in your skin cells from falling asleep in a tanning bed, how will this affect your offspring? Group of answer choices It won't affect them because mutations cannot be passed down to offspring It will affect their entire body because their entire body grew out of the fertilized egg It will affect your offspring's skin cells only It may affect them, depending on whether those particular skin cells are passed on to them It won't affect them because the mutation is not in a gamete
what does thi statement means Disease-Causing MutationsAre Hidden in a Sea of Variation?
Occasionally, a person is found who has one blue eye and one brown eye or who has a sector of one eye a different color from the rest. Can these phenotypes be explained by new mutations? If so, in what types of cells must the mutations occur?
Which of the following statements best describes the effect of mutations in DNA? A Mutations result in changes that can be positive, be negative, or have no consequences B Mutations result in changes that always have negative consequences C Mutations result in changes that cannot be detected unless it is revealed by genetic screening D Mutations result in changes that have no consequences
Of those in the following list, which organ(s)/tissue(s) is/are affected by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? select all that apply a. pancreas b. skin c. heart d. eyes e. spine and skeleton f. colon
Which of the following is NOT true about the agouti gene? -methylated gene results in a brown coat -different amount of methylation result in different fur pigmentation -diet supplement can influence methylation -the gene can be methylated and unmethylated during an individual's life
explain the statement Duplications Provide Extra Gene CopiesThat Can Acquire New Functions
Which of the following includes all of the others? a. homeotic genes c. SRY gene b. master genes d. PAX6
Although it is well known that X-rays cause mutations, they are routinely used to diagnose medical problems, including potential tumors, broken bones, and dental cavities. Why is this done? What precautions need to be taken?