All are single-electron carriers EXCEPT: a. UQH2. b. Cyt bL. c. Cyt bH. d. Rieske protein Fe-S clusters. e. Cyt c1.   2.The energy input for the synthesis of glycogen occurs during which of the following enzyme catalysed steps? a. phosphoglucomutase b. UDP-glucose pyrophTosphorylase c. glycogen synthase d. amylo-(1,4®1,6)-transglycosylase e. none of the above require energy input

Q: Which of the following statements is FALSE regarding oxidative phosphorylation? The pH is higher in…

A: Cellular respiration is a collection of three metabolic pathways that generate ATP by oxidation of…

Q: Consider the pyruvate carboxylase reaction, the first bypass step in gluconeogenesis: Pyruvate + CO₂…

A: Gluconeogenesis is a process by which cells make glucose from non carbohydrate sources.…

Q: Why do some starch products set as they cool?

A: Introduction Starch is a carbohydrate which is commonly found in nature like wheat, rice, potatoes…

Q: Now use the equations above and the empirical values below to calculate VO₂ (the rate of oxygen…

A:

Q: 1) What is the full name of the following molecule? 2) Briefly explain the functions of this…

A: The biochemistry of cells is greatly influenced by a variety of biological components. These…

Q: Create your OWN diagram to show the lock-and-key theory of enzyme activity.

A: There are two theories describing enzyme activity. They are: 1) Lock and Key Theory and 2) Induced…

Q: Identify three enzymes and the scientists who worked on them. What are the importance of these…

A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…

Q: The figure below illustrates what reactions of amino acids? coo &C=0 CH₂ CH₂ 0=( 00 + NHⓇ NAD(P)H+H…

A: The amino group, carboxyl groups, and side chains of amino acids all play a role in how amino acids…

Q: For each of the structures listed below identify the class of lipids to which it belongs (fatty acid…

A: Lipids are biomolecules that do not have a fixed chemical structure like carbohydrates or amino…

Q: The function of the Electron Transport Chain (ETC) in eukaryotic cells is to produce a proton…

A: In the electron transport chain (ETC), the electrons pass through four enzyme complexes, that…

Q: The condensation reaction catalyzed by ß-ketoacyl-ACP synthase synthesizes a four-carbon unit by…

A: Malonyl CoA is formed from carboxylation of Acetyl CoA through an ATP consuming process by biotin…

Q: Lipids supply more than twice as many calories as carbohydrates. Based on the results of the Sudan…

A: Sudan III is a dye that is used to stain lipids. When Sudan reagent is added to a solution…

Q: The majority of water and electrolytes are absorbed in which segment in the gastrointestinal tract?

A: The large intestine.

Q: What are the essential amino acids and how does the body get them? Give an example of one of them…

A: DISCLAIMER FOR MULTIPART Since you have posted a question with multiple sub-parts, we will solve…

Q: NH₂ Methyltransferases NH₂ OH OH S-Adenosylmethionine (SAM) Transamination B Phosphate transfer…

A: Methyl metabolism is well conserved across bacteria to humans. S-Adenosyl methionine (SAM) is…

Q: 6-25 For Umax 57(Kr+S) constant an enzyme that displays Michaelis-Menten kinetics, what is the…

A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…

Q: quantitative testing methods. Discuss two of them. (macromolecules lab questions) ( tests for…

A: Qualitative tests tell us whether or not the biomolecule of interest is present in a sample.…

Q: 7. H 1 H-C -OH H-C-OH 1 H -C 8. H 9. НО I 1 H J=D 0=)) с HIV-H OH HH -C-C-H I OH OH F-DIE-DI - CH…

A: 7. Chemical formula for structure number 7. = C4H8O4 or C4(H2O)4. Yes, this structure is a…

Q: Fill in the blanks: In the peptide, LASALLEDASMA, (Write the full name of the amino acids) has the…

A: The amino acid composition of the given peptide is as follows:…

Q: Which of these are components of animal fatty acid synthase (FAS)? B-ketoacyl reductase enoyl…

A: The majority of healthy human tissues primarily create new structural lipids from circulating…

Q: The side chain of cysteine contains: OA) a hydroxyl group OB) an amine group C) a carboxyl group OD)…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: In gluconeogenesis, how is glucose-6-phosphate converted to glucose? is converted to glucose by…

A: Gluconeogenesis is a metabolic process that converts non-carbohydrate carbon substrates such…

Q: Which of the following is zwitterion structure of the amino acid alanine? O NH3 NH3 O NH₂ O OH O no…

A: Amino acids are biomolecules that have an amino group (-NH2), a carboxyl group (-COOH) and a side…

Q: Why doesn't the enzyme bromelain digest the proteins in your stomach when you eat fresh  pineapple?

A: Enzymes are high molecular weight protein molecules that catalyse biochemical reactions. The…

Q: What effect is seen on a Lineweaver-Burke graph when a competitive inhibitor is added to an…

A: Competitive inhibition is an enzyme inhibition process where an inhibitor molecule (similar to the…

Q: Select the correct response:

A: Tyrosine gives rise to catecholamines which includes dopamine, norepinephrine, and epinephrine.

Q: Analyze each item carefully and write your complete solution. Cysteine is an important amino acid…

A: Note: As per the honor code we are allowed to answer the first two questions. Kindly resubmit the…

Q: What would be the standard free energy change if FADH 2 is used to reduce O 2 to water? Standard…

A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…

Q: Calculate the pI for the following peptide: Phe-Lys-Glu-Asp-Lys-Ser-Ala (note: there is only one…

A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…

Q: Which of the following enzymes requires Mg2+ to carry out its function? Alcohol dehydrogenase.…

A: An enzyme draws substrates to its active site, catalyzes the chemical reaction that creates the…

Q: Events that occur in the peroxisomes incluce the following EXCEPT     oxidation of fatty acids…

A: Peroxisomes are small, membrane-bound organelles in eukaryotic cells that contain enzymes involved…

Q: KINETIC CONSTANT No Na2HPO4 25mM Na2HPO4 50mM Na2HPO4 Vmax nmol p-NP. Min- 20.3252 14.30615 17.30104…

A: Active site is the site where a substrate molecule binds with an enzyme. The binding between a…

Q: 385 What acts as a reductant in the glutamate synthase reaction to catalyze the transfer of the…

A: Reductant is a substance that donates electrons to another substance and reduce it. In an…

Q: Can you help with 1a please HELPFUL INFORMATION: When performing classical Sanger or "dideoxy"…

A: Sanger sequencing is done to identify the sequence of DNA. In this process, a particular ddNTP is…

Q: i) Re-arrange with the Michaelis Menten equation so it involves the ratio [S] Show all steps…

A: Michaelis-Menten equation A mathematical model called the Michaelis-Menten equation is used to…

Q: (pmol) (a-32P) GMP INCORPORATED N 111 (a) (b) (c) 20 5 (min) 2.6 10 The image above shows an…

A: In eukaryotes the RNA Polymerase II is involved in the synthesis of mRNA. The RNA polymerase and…

Q: Which is an appropriate statement of involvement of the hydrophobic effect in protein folding? A)…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: A peptide has the following amino acid composition: 2 Met, 2 Phe, 2 Glu, 1 Arg, 1 Lys, 1 Val, 1 Leu,…

A: Recall that: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal…

Q: Suppose that the pH of distilled water is 6.2, what will be its resulting color using phenol red.

A: The pH of a solution refers to the H+ ion concentration in the solution. A solution with a pH lower…

Q: Hair is comprised largely of keratin, a fibrous protein consisting of two a-helices wrapped around…

A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…

Q: What is the physical or structural difference between heterochromatin (also called "heterochromatic…

A: The term "chromatin" describes the DNA and protein combination that makes up the chromosomes present…

Q: Under aerobic conditions of high ratios of NADH/NAD+ and ATP/ADP, as pyruvate is utilized for its…

A: Glycolysis: The process through which glucose is broken down to create pyruvate in a cell's…

Q: What explains the 10,000 to 1 selectivity of the potassium channel for K+ over Na+ considering that…

A: Channels are membrane proteins that allow biomolecules or ions to pass through them. Ion selective…

Q: The first reaction in glycolysis is the phosphorylation of glucose to form glucose 6-phosphate: P: +…

A: Given Values: ∆G°=13.8 kJ/mol or 13800 J/mol[Pi] = 5 mM[Glucose] = 5 mM

Q: 3. DNA: TACGGGCCTATACGCTACTAC TCATGGATCGG mRNA: Codon: Anitcodon: Amino Acids:

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: 10. The final electron acceptor in the electron transport chain is Complex IV. T F

A: The final stage of aerobic respiration is the electron transport chain (ETC), which is also the sole…

Q: 13. Linear regression analysis was performed for the calibration standard data set based on this…

A: Concentration of any unknown sample can be found out from a standard curve. The standard curve is…

Q: Given 2 M Tris, pH 7.1 (pKa 8.0), 5 M NaOH, 5 M HCI, and water; how would you prepare 2 L of 0.2 M…

A: Equation of dilution: M1V1 = M2V2 where: M1 is the molar concentration of the stock solution. M2 is…

Q: In the free energy diagram below, molecule A (with energy x) is converted to molecule B (with energy…

A: Activation energy for a reaction is the minimum amount of extra energy that is necessary for the…

Q: When disaccharides are heated in the presence of a strong acid, the linkage joining the two…

A: There are four types of biological macromolecules, nucleic acids, proteins, carbohydrates and…