Transcriplioh nie For cuch of the following sequences, fill in either the DNA, the mRNA sequence, the tRNA anticodons, or the amino acid sequences that have been left blank. If several sequences might work choose any one. ang IAC TGA ICGACC ccc ATA ATG AAA ATC 1. DNA MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG uAC UGA ucG ACC CcC AuA AUG AMA Auc (RNA AA 2. DNA TAC CGC ТСС GCC GTC GAC AAT АСС АСТ AuG GcG AGG CGGCAG cUl uuA UGG uGA MRNA UAG CGCUCC Grs Guc GAC AAu ACC Acu tRNA AA TAC CGT GGG TTT TTC ATG GT ī GGG IAA AuG GuG GGG GCA UAC cGA CCC uUA UAG 3. DNA mRNA tRNA UAC CAC ССС CGU AUG GCU GGG A AU AUC

Q: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’…

A: 5' cap  help in translation and prevent degradation of m- RNA  and poly A tail help on initiation of…

Q: DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in…

A: DNA ( deoxyribonucleic acid ) is the hereditary material in humans and almost all other organisms.…

Q: Why are some transposons medically important?

A: Certain sequences are repetitive such as satellite DNA, transposable elements, etc. They are studied…

Q: MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA…

A: The translation is a process in which the genetic information in the mRNA strand is converted into…

Q: How many bp in length is the fully processed MRNA if it contains a 50 bp poly A tail. Draw the fully…

A: DNA and RNA differ in only one of the four nitrogenous bases. RNA has uracil instead of thymine. DNA…

Q: A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the…

A: Gene is the structural and functional unit in the DNA. Genes are composed of nucleotide nitrogenous…

Q: 3. You have assembled a very short contig below, but you don’t know if this is the sense or…

A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…

Q: RNA sequence of A gene       If we have the following mutations, find the type of the mutation…

A:

Q: Provide the correct sequence of steps in each process described below. Write the letters in series…

A: Translation involves “decoding” a messenger RNA (mRNA) and using its information to build a…

Q: m

A: DNA → RNA RNA → protein

Q: The coding strand of a mutant gene A allele is shown below. On the space provided, type the…

A: The translated product of mutant gene will contain the amino acid synthesized from the transcribed…

Q: TAC CTA CTC TAG TTA ACCACA GTT GCCATC Transcribe the given template strand of DNA:I Second mRNA base…

A: The Genetic code is  :  1. Universal 2. Redundant 3.Non Ambiguous Genetic Codon have start and stop…

Q: sequence belo - Indicate the start site for translation by underlining the start codon. - Translate…

A: mRNA sequence 5' GUAGUCAUGCCCGACGCAUUUACGAUUCAGUGACUG 3'. The codons are triplet in nature and the…

Q: Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the…

A: Introduction The process of duplicating a DNA molecule is known as DNA replication. When a cell…

Q: codons that specify the amino acid Vavne (Val), demonstrating the enet There are Second letter 1U C.…

A: There are 4  codons that specify the amino acid valine, demonstrating the genetic code  is…

Q: Ôn the space provided, type the translation product of wild-type gene A (use three- letter…

A:

Q: The template strand of wild- type gene A is shown below. On the space provided, type the translation…

A:

Q: Fill in the complementary DNA strands for the DNA strands below Which nitrogen base CAN'T you use…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Prokaryotic Eukaryotic FRNA MRNA TRNA hnRNA snRNA FRNA get of zibiotic ugs pped to pid Terioration…

A: Introduction :-  RNA is a polymeric molecule . Role of RNA  in different cellular processes ==…

Q: MRNA 20 ORI 40 - FTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGHAATATOGGGATGCACTATC…

A: Gene expression includes transcription  and translation. It leads to synthesize mRNA and protein…

Q: a) The following nucleotide sequence is found on the template strand of DNA: 3' - TAC TGG CCG TTA…

A: We are answering four parts  For rest of parts pls repost.

Q: Give the amino acid sequence of the protein encoded by the mRNA in Figure 15.21.

A: Translation is the process of formation of protein by decoding the nucleotide sequence of an mRNA.…

Q: A template strand of a gene contains the sequence 3’ – TTCAGTCGT – 5’. Suppose that the nontemplate…

A: Given: A template strand of a gene contains the sequence 3’ – TTCAGTCGT – 5’.

Q: 5' AGGGUUUGGGAUGAAUCGACGACGAUCCUACGUACUAAGUA 3' Write the amino acid sequence for this portion of…

A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…

Q: Why is it important that the correct reading frame is used?

A: DNA contains both coding and non-coding region where introns are non-coding regions and exons are…

Q: As opposed to DNA replication or transcription, translation requires the correct reading frame.…

A: A double-stranded DNA molecule can read in any of six possible reading frames- three in the forward…

Q: The sequence below shows the non-coding strand from the whole of the transcribed region of a very…

A: DNA undergoes transcription process to synthesize mRNA, which undergoes translation to synthesize…

Q: Transcribe the following DNA sequence.  Then translate the resulting mRNA transcript.…

A: Mutation is any change in the DNA sequence. It can alter the protein sequence because the proteins…

Q: decode the following mRNA strand into the appropriate amino acid sequence (assume the first 3…

A: m-RNA undergoes translation to form proteins. The correct form of the amino acid sequence is 5’- AUG…

Q: Following is the nucleotide sequence in a segment of a strand of DNA 5'- AATTGGCTCTATAAT-3' Give the…

A: Adenine, thymine, guanine, and cytosine are the bases of the DNA. The mRNA is a single-stranded…

Q: Let's Apply In each of the following DNA sequences, write on your answer sheet the corresponding…

A: DNA ( Deoxyribonucleic acid ) is two stranded helical structure which act as genetic material in…

Q: A protein has the following amino acid sequence:…

A: The process of translation requires transfer of genetic information from a polymer of nucleotides to…

Q: Your labmate gives you a gene with the following sequence of the coding strand for the first 5 amino…

A: given DNA strand first form the complimentary starnd by changing A - T and G-C for the strand 3' to…

Q: UACTyrosine (Tyr) Fcysteine (Cys) Consider the following DNA coding strand: 5' - ATGTACGGC GAATAA-3'…

A: Within the biological system, the flow of genetic information is explained as molecular biology's…

Q: pc*00ATAAADDATATAJOTTAA 1. Use the genetic code table and the information in the diagram below to…

A: Translation, in molecular biology and genetics, is the process by which ribosomes in the cytoplasm…

Q: 5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle…

A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: A TRNA molecule with the anticodon GCU would be carrying the amino acid: Secend ha f cod Three-er…

A: Ribonucleic acid (RNA) comprises a Ribose sugar along with a phosphate group and nitrogenous bases.…

Q: A) Based on the mRNA sequence below, provide the corresponding DNA template (5'-3') and protein…

A: DNA is the genetic material in humans. It carries information that is transferred from one…

Q: A protein has the following amino acid sequence:…

A: Given: In the given question stem, sequence of amino acid is given and we have to make set of probes…

Q: c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the…

A: Introduction :- In moelcular biology , the expression of gene is the most important event , that…

Q: b. FALSE Unanswered a Save 58 What segments of the pre mRNA comprise the coding region? pre-mRNA 5'…

A: Introduction :- When an RNA transcript is first produced in a eukaryotic cell, it is referred to as…

Q: TATACACCAGAGCCAGGCAATCCGTTA 8.1. Which strand functions as the transcription template, the top one…

A: The template strand of DNA serves as a template for synthesis of a complementary RNA transcript. The…

Q: TGTACACATGTCCGAAACAGACTTACCGAA-5

A: For the given DNA Sequence , the translated mRNA  is as follows_  3'TGTACACATGTCCGAAACAGACTTACCGAA5'…

Q: Some exons in the human genome are quite small (lessthan 75 bp long). Identification of such…

A: Alternative RNA splicing is a fundamental post-transcriptional regulatory process that results in a…

Q: summarize these results using concise language in a neat table;   Control : 5’…

A: There are different types of mutations based on the changes in DNA sequences. It includes missense,…

Q: mutation each as Deletion, Insertion or Substitution AND as either , missense, silent or nonsense…

A: In this question, we have to identify the type of mutation in the given DNA sequence.

Q: A small section of bacterial mRNA has the following nucleotide sequence: GAC CCG AUG AAC The tRNA…

A: Translation  It is the synthesis of proteins from the codons present in the mRNA. Anticodons…

Q: A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the…

A: During protein synthesis, the nucleotide sequence of the mRNA is read in the form of triplets.

Q: A protein has the following amino acid sequence:…

A: Amino acids- Amino acids are organic compounds that combine to form proteins. Amino acids and…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: Translation is the process of synthesis of proteins from mRNA. During the process of translation,…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.