An extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3' 3' splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream. Normal 3' end of intron 5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3' 5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3' What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.
Q: 36. How many different amino acids would be found in a polypeptide made from translation of an RNA…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: 1. In the sugar-phosphate backbone of DNA, the phosphate group is located in the 3’ end while the…
A: 1. In the sugar-phosphate backbone of DNA, the phosphate group is located in the 3’ end while the…
Q: reduction in histone acetylation and reduced gene transcription. Given this information, which of…
A: Transcription is a highly controlled process and it requires the presence of enzymes polymerase and…
Q: 2) Myoclonal epilepsy and ragged red fiber disease (MERRF) is a human condition named for the ragged…
A: Mitochondrial tRNA in humans has gained interest due to the discovery of associations between point…
Q: How many sites? A researcher has isolated a restriction endonuclease that cleaves at only one…
A: Restriction endonuclease is defined as an enzyme responsible for cleaving DNA into small fragments…
Q: RNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA, This strand…
A: Transcription is the process of transforming the information of DNA sequences in to the mRNA strand.
Q: Tick the correct statements: Remember: Tautomers are structural isomers that differ from each…
A: Ans). The first statement, the third statement, and the fourth statement are correct. Explanation:…
Q: Met-enkephalin (Tyr–Gly–Gly–Phe–Met) is a painkiller and sedative (Section 21.5). What is a possible…
A: Metenkefalin could be an artificial kind of the naturally occurring, endogenous opioid amide,…
Q: Alpha polypeptide (ADH1A). Give a detailed description of its role in the disease. Describe the…
A: Alpha polypeptide (ADH1A)- Alcohol dehydrogenase 1A is a type of enzyme which in humans it is…
Q: Structure of lactam.. 1) Why this lactam would be evolutionarily selected against? a. Amino acids…
A: β-lactam antibiotics are antibiotics that contain a beta-lactam ring in their chemical structure.…
Q: 2) Myoclonal epilepsy and ragged red fiber disease (MERRF) is a human condition named for the ragged…
A: Myoclonic epilepsy:It is related to a family of epilepsies which are present along with myoclonus.…
Q: Which of the following is false? a. Methyl, phosphoryl, adenyl, uridylyl and adenosine diphosphate…
A: Enzymes are basically proteins that are intricately packed inside with the help of intramolecular…
Q: Suggest a reason why the proofreading step in protein synthesis takes place at the level of amino…
A: Proofreading refers to a mechanism for correcting errors in the translation process. It helps to…
Q: What is a haplotype?
A: Single base pair changes in the DNA sequence such as deletions, insertions between two human genomes…
Q: 16)(comprehension) Suppose the following DNA sequence was mutated from 3'-AGAGAGAGAGAGAGAGAG-5' to…
A: The central dogma states that DNA undergoes transcription to form mRNA which then gets translated to…
Q: 6. Celiac disease is a disorder of the small intestine characterized by autoimmune response to…
A: Gluten protein is commonly found in many cereals like Wheat, barley, rye etc and is difficult to…
Q: True or false?: The CTD is responsible for mRNA-processing steps that are specific for mRNA and not…
A: BASIC INFORMATION TRANSCRIPTION It is responsible for the formation of hnRNA which has the codes…
Q: Be sure to answer all parts. Consider the following mRNA sequence: 5'-GCU AGG CGA-3'. a. What amino…
A: Translation is the process in which the m rna is converted into a polypeptide chain of amino acids…
Q: stranded helix by doubling back. Draw the detailed chemical structures for all the base- pairing…
A: Triple helix The triple-stranded DNA is also called the H-DNA, it is called so because three…
Q: Contrast DNA replication with gene expression (transcription→translation)—when does each occur?
A: DNA replication is the bio-process by which the double-helix DNA system is duplicated, whereas gene…
Q: Describe the function of each of the following Shortly. a. Amino-acyl tRNA synthetase b. E…
A: a. Amino-acyl tRNA synthetase The tRNAs are activated or charged with the aminoacid in the two step…
Q: how many amino acids and omega bonds? How many amino acids appear to have undergone a…
A: Amino acids are amphoteric, colorless, and crystalline solids. They are soluble in water and…
Q: TRNAS do vary in length. True False
A: RNA is ribonucleic acid which is formed from DNA .It is further of three types :- A )rRNA (…
Q: Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of…
A: The replication, transcription and translation are the very important processes in cell biology that…
Q: ing the following DNA sequence determine the amino acid sequence: AGAGGTCCGCGTTTAGACAT5' et Val Ser…
A: Complementary strand of RNA is formed by complementary base pairing that occurs between adenine and…
Q: True or False? The +1 transcription start site (+1 tss) occurs at the end of the 5' untranslated…
A: Transcription start site: This is the region of DNA upstream of 5'UTR from where transcription of…
Q: A lot of time and energy put into creating tRNAs; why?
A: A transfer RNA is a kind of RNA molecule that helps to match an mRNA codon with the amino acid it…
Q: The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…
A: Mutation is the alteration in the genome sequence. It can occur in the genetic code of eukaryotes,…
Q: Examining Figure 20-8, explain why the rate of evolutionat nonsynonymous sites is lower. Do you…
A: Introduction A mutation is a change in an organism's DNA sequence. Mutations can occur as a result…
Q: HbS results from the substitution of valine forglutamic acid at the number 6 position in the b…
A: HbS is the result of a single base-pair mutation in the gene responsible for the beta-globin chain…
Q: 1) Histone demethylases are important enzymes in epigenetics, and are alpha ketoglutarate-dependent…
A: Histone demethylases control the methylation state at the histone protein also stabilize the…
Q: Choose the correct option for following three mcqs 7.The first step in the capping reaction is…
A: Introduction: The correct choice is "phosphatase". The correct choice is "RNA polymerase-II". The…
Q: Mutated DNA Sequence #4 ТАСАС СТTGG CGACT АСТ... What's the mRNA sequence? (Circle the change) amino…
A: DNA is two stranded structure which make it own strand via replication process . It comprises of…
Q: 1.The RNAs acting in RNAi are about 18 nucleotides long. To judge whether it is possible to uniquely…
A: Introduction RNA Interference (RNAi) Is A Biological Mechanism In Which Double-stranded RNA…
Q: Leaderless. The MRNA for the A repressor begins with 5'-AUG-3', 5'-AUG-3', which encodes the…
A: mRNA or messenger RNA is the molecule synthesized during the process of transcription from the DNA…
Q: Matching Match each item with the correct statement below. Not all terms will be used a. 5' GTP cap…
A: Introduction Gene expression is the process through which information from a gene is utilised in the…
Q: replication, resulting in a (e) Errors may change to the sequence of base triplets. Explain how a…
A: Ans- Errors that arise during the DNA replication because of the change in sequence of gene triplets…
Q: Assume that the translational error frequency, 8, is 1 × 10-4. (a) Calculate the probability of…
A: The translation is the process of making a polypeptide chain from mRNA. The translation is catalyzed…
Q: H2N 1.) Look carefully at this nucleotide: N- || НО-Р-О- N. OH a.) Number the carbons in the sugar…
A: DNA is a long, double-stranded, helical molecule composed of building blocks called…
Q: Hi, help please. Which of the following is TRUE regarding RNA editing? a .The coding sequence is…
A: RNA editing is a process of modification, in which nucleotide sequences are changed within an RNA.
Q: Only answer please, no need to explain… Thank you for your time. i: Modification of the 5 prime…
A: Answers : i) capping ii) all of these iii) transcription
Q: True or False? Eukaryotic genomes are organized into operons; each operon consists of a series of…
A: The operons are specialised portions of genetic material which have jobs of regulation and control…
Q: the relationship between mutation of RECQ5 and human disease, in particular exploring the effects on…
A: RECQ5:- it is a type of helicases. It is an ATP dependent helicase that can binds with single…
Q: Mutation: Thiamine Dimers A. what is a mutagen or cellular process that leads to this mutation? B.…
A: DNA damage occurs either due to mutation or error that occurs during the processing of DNA such as…
Q: Explain how these mechanisms affect protein diversity.
A: Post-translational Modification (PTM) generally refers to the large enzymatic adjustment of proteins…
Q: TRNA serves as template for the synthesis of polypeptide. True O False
A: Protein biosynthesis is a major biological process that occurs inside cells and balances the loss of…
Q: UESTION 16 Which of the following best describes the proper sequential order of the dogma of…
A:
Q: Complementation and mapping analyse of Lac− mutants
A: Introduction: The lactose operon is a type of operon that is needed to transport and metabolize…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Remember remove the introns! All introns start with GT and end with AG.INSTRUCTION: Given the DNA sequence below, provide the answers to the following items. a. complimentary DNA strand 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C b. mRNA 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C c. protein synthesized 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A CRegulation of Genes and Their products 1. Given the following genotypes, explain how the mutation (identified by a (-) superscript) wil affect E. coll grown in lactose medium. Will the lac operon be on or off? Will there be a complete set of gene products from the lac operon? What will be the implication of the missing gene product, if ever? Will the cell be able to survive in the lactose medium or not? a. I+p+o+z- y+ b. i- p+o+z+y+ c. i+p+o- z+y+ d. i+p- o+z+y+ 2. In terms of the trp operon, differentiate between two normal bacterial cultures, one grown in a medium supplied with tryptophan and the other medium without tryptophan. 3. Experiments show that mutations at gene E lead to non-repressible transcription of trp genes. Why?
- PLEASE ANSWER WHY? Some substitution mutation result in a malfunctioning protein but others do not. Why is this? True or false?: The CTD is responsible for mRNA-processing steps that are specific for mRNA and not for other forms of RNA. Explain why you chose true or false.Tick the correct statements: Remember: Tautomers are structural isomers that differ from each other based on the position of the proton(s) and their double bonds. ( ) The nitrogenous bases of nucleic acids, which contain heterocyclic and analogous nuclei, can adopt different tautomeric forms involving multiple H+ that are exchangeable depending on the medium. In DNA, spontaneous formation of smaller tautomers appears to contribute to mutagenic errors during DNA replication, while in RNA, they seem to be related to increased structural and functional diversity of enzymes and RNA aptamers (research this and confirm if it is false or real) ( ) in relation to the figure, anomer 1 has beta stereochemistry with respect to the C anomeric of the pentose, and is making an N-glycosidic bond ( ) in relation to the figure, anomer 1 has alpha stereochemistry with respect to the C anomeric of the pentose, and is making an N-glycosidic bond ( ) In general, in naturally occurring nucleosides,…
- Central Dogma of Molecular Biology from DNA to RNA to Protein, discussing the principles underlying the transfer of information in a biologic system and its regulation. However, recent research seems to challenge certain aspects of Crick’s Central Dogma. Does the Central Dogma still stand today? If not, can you find an example for a type of information transfer that is not explicitly covered by the Central Dogma (or even violates it)?100All tRNA molecules have poly (A) tails at their 3' end. YesornoSuggest a reasonable strategy for the specific phosphorylation of the5’ –OH group of a nucleoside.
- How many sites? A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-base-pair site. Would this enzyme be useful in protecting cells from viral infections, given that a typical viral genome is 50,000 base pairs long? ExplainTrue or False? Eukaryotic genomes are organized into operons; each operon consists of a series of genes which code for enzymes involved in a metabolic pathway, under the transcriptional control of a single promoter sequence .Calculating human genome If 1.5 percent of the human genome consists of protein-coding sequences, and the entire genome has 3.2x10^9, how many codons are there in the human genome? Remember that a codon is three nucleotides in length.