The genetic code was solved partly by the use of in vitro systems to translate synthetic RNAs into peptides. In these systems, ribosomes, amino acids, and buffers that support translation are added and there is no control of where translation begins. AAA = Lys; AUA = Ile; AAU = Asn; UAA = stop. What peptides would NOT be produced in an in vitro system if the following oligonucleotide were added: AAAAAAAAAUAAAAAAAA Select one: a) Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys b) Lys-Lys-Ile-Lys-Lys c) Lys-Lys-Asn-Lys-Lys

The genetic code was solved partly by the use of in vitro systems to translate synthetic RNAs into peptides. In these systems, ribosomes, amino acids, and buffers that support translation are added and there is no control of where translation begins. AAA = Lys; AUA = Ile; AAU = Asn; UAA = stop. What peptides would NOT be produced in an in vitro system if the following oligonucleotide were added: AAAAAAAAAUAAAAAAAA Select one: a) Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys b) Lys-Lys-Ile-Lys-Lys c) Lys-Lys-Asn-Lys-Lys

Name: The genetic code was solved partly by the use of in vitro systems to t
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: The genetic code was solved partly by the use of in vitro systems to translate synthetic RNAs into peptides. In these systems, ribosomes, amino acids, and buffers that support translation are added and there is no control of where translation begins.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 18QP: The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this...

See similar textbooks

Similar questions

Many antibiotics are effective as drugs to fight off bacterial infections because they inhibit protein synthesis in bacterial cells. Using the information provided in the following table that highlights several antibiotics and their mode of action, discuss which phase of translation is inhibited: initiation, elongation, or termination. What other components of the translational machinery could be targeted to inhibit bacterial protein synthesis? Antibiotic Action 1. Streptomycin Binds to 30S ribosomal subunit 2. Chloramphenicol Inhibits peptidyl transferase of 70S ribosome 3. Tetracycline Inhibits binding of charged tRNA to the A site of the ribosome 4. Erythromycin Binds to free 50S particle and prevents formation of 70S ribosome 5. Kasugamycin Inhibits binding of tRNAfMet 6. Thiostrepton Prevents translocation by inhibiting EF-G
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ Following translation process, what is the amino acid sequence that will be coded for? (show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus)
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ Following translation process, what is the amino acid sequence that will be coded for? (show your answer using ONE-letter amino acid code starting from N-terminus to C-terminus)
A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the following amino acid sequence: Met-ProIle-Ser-Ala. What would be the effect on translation if the following component were omitted from the cell-free protein-synthesizing system? What, if any, type of protein would be produced? Explain your reasoning. Q. GTP
A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the following amino acid sequence: Met-ProIle-Ser-Ala. What would be the effect on translation if the following component were omitted from the cell-free protein-synthesizing system? What, if any, type of protein would be produced? Explain your reasoning. Q. ATP
If there are 64 possible codons in the genetic code and the amino acid is specified by each, as read in the 5’ to 3’ direction from the mRNA sequence, which ones are STOP codons?
The wobble rules for tRNA-mRNA pairing are shown. If we assume that the tRNAs do not containmodified bases, what is the minimum number of tRNAs needed to recognize the codons for the following types of amino acids? A. Leucine B. Methionine C. Serine
A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the following amino acid sequence: Met-ProIle-Ser-Ala. What would be the effect on translation if the following component were omitted from the cell-free protein-synthesizing system? What, if any, type of protein would be produced? Explain your reasoning. Q. Elongation factor Tu
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the following amino acid sequence: Met-ProIle-Ser-Ala. What would be the effect on translation if the following component were omitted from the cell-free protein-synthesizing system? What, if any, type of protein would be produced? Explain your reasoning. Q.Release factors RF-1, RF-2, and RF-3
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand?
For the m-RNA nucleotide codons given below, what is the corresponding sequence of amino acids? AUG UGU AUA UAU GUA AUC ACC UUC UAU GUA ACA UUU UGG AAC AGC UGC CAU GUA UAC CAG AAA CUU GCA GAG CUG GCU UUG AUA UGA The α-helices are known to contain primarily the amino acids methionine, alanine, leucine, glutamate, and lysine, while β-pleated sheets are known to primarily contain the amino acids tryptophan, tyrosine, phenylalanine, isoleucine, valine, and threonine. Which one of these two types of secondary protein structure is present with this amino acid sequence?