B. One strand of a section of DNA isolated from E. coli reads: (Assume no start codon is required as is true under certain test tube conditions). 5' GTAGCCTACCCATAGG 3' 1. What is the complementary DNA strand? 2. Suppose mRNA is transcribed from this DNA using the complementary strand as a template. What will be the sequence of the mRNA? 3. What would be the corresponding anticodons? 4. What peptide would be made if translation started exactly at the 5' end of this mRNA?

B. One strand of a section of DNA isolated from E. coli reads: (Assume no start codon is required as is true under certain test tube conditions). 5' GTAGCCTACCCATAGG 3' 1. What is the complementary DNA strand? 2. Suppose mRNA is transcribed from this DNA using the complementary strand as a template. What will be the sequence of the mRNA? 3. What would be the corresponding anticodons? 4. What peptide would be made if translation started exactly at the 5' end of this mRNA?

Name: B. One strand of a section of DNA isolated from E. coli reads: (Assum
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: B. One strand of a section of DNA isolated from E. coli reads: (Assume no start codon is required asis true under certain test tube conditions).5' GTAGCCTACCCATAGG 3'What is the complementary DNA strand?2. Suppose mRNA is transcribed from this DNA u

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 12TYK: Discuss Concepts The normal form of a gene contains the nucleotide sequence: When this gene is...

See similar textbooks

Similar questions

B. Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a transition leading to a silent mutation in the second amino acid. Bold or underline the nucleotide that has been changed
b) Discuss the characteristic of DNA polymerase 1, Nick translation Proofreading
Illustrate the process of transcription by providing the correct bases for mRNA strand given the DNA template strand. (Remember that mRNA has uracil instead of thymine.) Template Strand: CGATACAAA
1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5 3 - GCCTACGGGCATATG -5 5 - GCCTACGGGCATAAG -3 5 - GCCTACGGGCATATG -3 3 - CGGATGCCCGTATAC -5 (b) Which is the DNA template given if the mRNA is 5 - CGGAUGCCCGUAUACGUA -3 ? 3 - GCCTACGGGCATATGGTA -5 5 - GCCTACGGGCATAAGGAT -3 5 - GCCTACGGGCATATGCAT -3 3 - CGGATGCCCGTATACCTA -5
1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…
1. From the given DNA strands:a. Identify the template and non-template strand.b. Give the mRNA product when the DNA is transcribed.c. What is the resulting amino acid sequence which will result from the mRNA?
C. Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence in the anticodons of tRNA, determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code. 1. DNA Template: TAC - GGC - TAC - CAT - ATG - GAG mrNA: tRNA: Amino acid sequence: 2. DNA Template: TTA - CAT - CAT - ATC - GAT - GAC mrNA: tRNA: Amino acid sequence: 3. DNA Template: CTA - GCG - ATA - AAA - TTT - ATT mrNA: tRNA: Amino acid sequence:
1. For the genotypes and conditions (lactose present or absent) shown in the following table predict whether functional enzymes, nonfunctional enzymes, or no enzymes are made. 2. Even though the LacZ,Y and A structural genes are transcribed as a single polycistronic mRNA, each gene contains the initiation and termination signals essential for translation. Predict what will happen when a cell growing in the presence of lactose contains a deletion of one nucleotide early in the Z gene and early in the A gene.
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
(b) Is the ubiquitination relatively stable or highly dynamic? how does ubiquitination become detached from the protein of interest? what enzyme is involved?
1. Given that a faulty ribosomal protein is the culprit and causes DBA, discuss the possible role of normal ribosomal proteins. Why might bone marrow cells be more susceptible to such a mutation than other cells? 2. A couple with a child affected with DBA undergoes in vitro fertilization (IVF) and genetic testing of the resulting embryos to ensure that the embryos will not have DBA. However, they also want the embryos screened to ensure that the one implanted can serve as a suitable donor for their existing child. Their plan is to have stem cells from the umbilical cord of the new baby transplanted to their existing child with DBA, thereby curing the condition. What are the ethical pros and cons of this situation? 3. While a stem cell transplant from an unaffected donor is currently the only cure for DBA, genome-editing technologies may one day enable the correction of a mutation in a patient’s own bone marrow stem cells. However, what specific information would be needed, beyond a…