9 O e. frameshift mutationQUESTION 9In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence of the gene is show below:3'5' ATGAATACAAACGTTCCAATATTCAGTTCTCCGGTCAGAGATTTACCAAGGTCTTTCGAATACTTATGTTTGCAAGGTTATAAGTCAAGAGGCCAGTCTCTAAACGGTTCCAGAAAGCTT 5'The modified sequence is shown below, with the mutation highlighted in bold:3'5'ATGAATACATAACGTTCCAATATTCAGTTCTCCGGTCAGAGATTTACCAAGGTCTTTCGAA 3'3' TACTTATGTATTGCAAGGTTATAAGTCAAGAGGCCAGTCTCTAAACGGTTCCAGAAAGCTT 5'Q2: What effect will this mutation have on Gal1 expression?O There will be no effectGal1 will always be ONGal1 will always be OFFGal1 will be expressed only when galactose is present in the cellGal1 will be expressed only when galactose is absent from the cellQUESTION 10Click Save and Submit to save and submit. Click Save All Answers to save all answers.a19G #tv

Name: 9 O e. frameshift mutationQUESTION 9In a lab, researchers induced a mu
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 9 O e. frameshift mutationQUESTION 9In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence of the gene is show below:3'5' ATGAATACAAACGTTCCAATATTCAGTTCTCCGGTCAGAGATTTACCAAGGTCTTTCGAATACTTATGTTTGCAAGGTTATAAGTCAAGAGGC

Abrupt changes in the DNA sequences are called mutations. these may or may not change the protein…

Science

Biology

QUESTION 9 In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence of the gene is show below: 3' 5' ATGAATACAAACGTTCCAATATTCAGTTCTCCGGTCAGAGATTTACCAAGGTCTTTCGAA TACTTATGTTTGCAAGGTTATAAGTCAAGAGGCCAGTCTCTAAACGGTTCCAGAAAGCTT 5' The modified sequence is shown below, with the mutation highlighted in bold: 3' 5' 3' 3' ATGAATACATAACGTTCCAATATTCAGTTCTCCGGTCAGAGATTTACCAAGGTCTTTCGAA TACTTATGTATTGCAAGGTTATAAGTCAAGAGGCCAGTCTCTAAACGGTTCCAGAAAGCTT 5' Q2: What effect will this mutation have on Gal1 expression? There will be no effect O Gal1 will always be ON O Gal1 will always be OFF O Gal1 will be expressed only when galactose is present in the cell O Gal1 will be expressed only when galactose is absent from the cell QUESTION 10

QUESTION 9 In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence of the gene is show below: 3' 5' ATGAATACAAACGTTCCAATATTCAGTTCTCCGGTCAGAGATTTACCAAGGTCTTTCGAA TACTTATGTTTGCAAGGTTATAAGTCAAGAGGCCAGTCTCTAAACGGTTCCAGAAAGCTT 5' The modified sequence is shown below, with the mutation highlighted in bold: 3' 5' 3' 3' ATGAATACATAACGTTCCAATATTCAGTTCTCCGGTCAGAGATTTACCAAGGTCTTTCGAA TACTTATGTATTGCAAGGTTATAAGTCAAGAGGCCAGTCTCTAAACGGTTCCAGAAAGCTT 5' Q2: What effect will this mutation have on Gal1 expression? There will be no effect O Gal1 will always be ON O Gal1 will always be OFF O Gal1 will be expressed only when galactose is present in the cell O Gal1 will be expressed only when galactose is absent from the cell QUESTION 10

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

The amino acid sequence of part of a protein has beendetermined:N . . . Gly Ala Pro Arg Lys . . . CA mutation has been induced in the gene encodingthis protein using the mutagen proflavin. The resultingutant protein can be purified and its amino acidsequence determined. The amino acid sequence of themutant protein is exactly the same as the amino acidsequence of the wild-type protein from the N terminus of the protein to the glycine in the preceding sequence. Starting with this glycine, the sequence ofamino acids is changed to the following:N . . . Gly His Gln Gly Lys . . . CUsing the amino acid sequences, one can determinethe sequence of 14 nucleotides from the wild-typegene encoding this protein. What is this sequence?
Need help 1.The RNAs acting in RNAi are about 18 nucleotides long. To judge whether it is possible to uniquely target a particular gene with an RNA of this size, consider the following calculation: what is the expected frequency of occurrence of a specific 18 nucleotide sequence? a.The probability of finding this sequence is ___ . b.Therefore, the frequency of occurrence of this sequence is one in ___ nucleotides. c.The fruit fly genome consists of 1.2×108 base pairs.Using the logic in part a., calculate the minimum length of a unique DNA sequence expected to occur by chance just once in the fruit fly genome. Length = __ base pairs
Problem B. DNA: Codon SegmentingThe way that DNA is often interpreted as genes is in groups of three nucleotides at a time, called “codons.” Thus, the DNA strand dna_str = 'agctttcattctgac' Can be broken into codons in the following three ways: agc ttt cat tct gac a gct ttc att ctg ac ag ctt tca ttc tga c # reading frame 0 # reading frame 1 # reading frame 2 Notice that in these lines, we start reading codons at string indexes 0, 1 and 2. The three different start indices are known as reading frames, and are called reading frame 0, reading frame 1 and reading frame 2, respectively. It is not always clear which of these frames will be read by genetic transcription mechanisms, so it is often useful to be able to be flexible and consider any of them when working with DNA strands. Write a function segment that takes as an input a string containing a DNA strand, and a reading frame (0, 1 or 2) to use. The function should return a list containing the sequence of individual codons. You…
1. Here is the amino acid sequence of part of a hypotheticalgene you want to clone:Pro-Arg-Tyr-Met-Cys-Trp-Ile-Leu-Met-Sera. What sequence of fi ve amino acids would give a 14-merprobe with the least degeneracy for probing a library tofi nd your gene of interest? Notice that you do not use thelast base in the fi fth codon because of its degeneracy.b. How many different 14-mers would you have to makein order to be sure that your probe matches thecorresponding sequence in your cloned gene perfectly?c. If you started your probe one amino acid to the left of theone you chose in (a), how many different 14-mers would youhave to make? Use the genetic code to determine degeneracy.
52Protein synthesis takes place on ( ). 53The eukaryotic pathway of polypeptide chain elongation is the same as the bacterial pathway except that eEF1A and eEF2 replace eF1A and EF2. Yesorno 54Which experiment show that σ70-RNA polymerase combines with promoter DNA to form a closed and an open complex?A.Footprintingb.Southern blottingc.ComplementationD.DNase protection
PLEASE FL OUT TABLE USING INSTRXUTIONS -USE BASE PAIRING RULES TO COMPLETE SECOND COLUMN FOR EACH MUTATION WRIYE IN ANY MRNA DOEONS RHAT WILL BE FHANGED AS THE REEULR OF RHE MURATION AND USE X MARKS RO INDÍCATE DOONS THAT WONT BE FHANGES CIRCLE STOP CODONS
100All tRNA molecules have poly (A) tails at their 3' end. Yesorno
Yes or no. No need explanation. dapi sho sperm and testes after feeding planarians with luciferase dsrna does cdna generate from genomic dna? Are 5' and 3' regions intronic sequence?
ANWER FAST NO NEED FOR LONG EXPLANATION 1. In the sugar-phosphate backbone of DNA, the phosphate group is located in the 3’ end while the deoxyribose is present in the 5’ end. Select one: True False 2. Not all missense mutations will lead to nonfunctional proteins. It all depends on where the substitution lies in the polypeptide chain and how it will affect protein folding and activity. Select one: True False 3.What component(s) is/are involved in transcription? a.Sigma factor b.RNA polymerase c.Promoter d.B and C e.All of the above
A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
5’ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’ 3’TAGCGCGATCCGCGTACGATGGATCCGATAGACGGATCGATAGCTGATTAGACTAGCTCAGTC5’ Write out the pre-mRNA for this geneWrite out the mRNA for this geneHow many amino acids does this protein have? Translate the protein Label your 5’ and 3’ UTR’s
a) Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR: 3’ UTR: